poniedziałek, 28 maja 2007

www.aquanet,......GENESIS....24.12.01


• samobojczyTerror IP: *.cm-upc.chello.se
Gość: d 12.04.02, 00:18 zarchiwizowany

Suicide Terrorism: The New Scourge
http://www.danielpipes.org/articles/1986summer.shtml
The National Interest
Summer 1986
[N.B.: The following reflects what the author submitted, and not exactly what
was published. To obtain the precise text of what was printed, please check the
original place of publication.]

Not Unique to the Middle East
Suicide missions are by no means peculiar to the Middle East. The medieval
Cathars of southern France and northern Italy "looked favorably on suicide, an
attitude which made the more fervent of them impervious to persecution." What
British and French soldiers did in World War I-leave their trenches to climb
over dead comrades and march into machine gun fire-was a form of mass self-
sacrifice that exceeds by far anything witnessed recently in the Middle East.
Nor was it just the front-line troops who marched off to their death. Vincent
Kraft, a German spy in World War I committed a serious offense while serving on
the Western front for which the penalty was death. Instead, Peter Hopkirk
relates, he was offered the alternative of undertaking what he described as "a
very dangerous mission" in the East.

Similarly, when ten Irish Republican Army members starved themselves in 1981,
taking 50 to 60 wrenching days, they endured a much more agonizing death than
that involved in the brief, almost painless acts of the suicide bombers in
Lebanon. Contrary to what many believe, Europeans are willing to give up their
lives for a cause on occasion. Suicidal acts are not unknown in the West.

Nor are they common among Muslims. Quite the reverse: suicide is as strictly
forbidden in Islam as in Judaism and Christianity. A Qur'anic verse, "Do not
kill yourselves" (4:29), is commonly understood to condemn suicide. The Prophet
Muhammad said that a suicide cannot go to paradise, and Islamic laws firmly
oppose the practice. Religious leaders today continue to reject suicide.
Muhammad Husayn Fadlallah, leader of the radical fundamentalist Shi'is in
Lebanon, remarked about the recent spate of bombings, "suicide in such a way is
forbidden in our religion."

Religious prohibitions have had effect; according to modern
scholarship, "suicide was of comparatively rare occurrence" in traditional
society. Notwithstanding the famous expectation that a Muslim who dies in the
service of God goes to paradise, Muslims were not more likely to end their
lives than other people. The only significant exception were the fida'is
(soldiers prepared to sacrifice themselves) sent out by the Assassin sect in
the 12th century.

These points need emphasis to correct a mistaken tendency to ascribe suicide
bombings in the Middle East to Islam, fanaticism, or some other cultural trait.
In fact, suicidal warfare in the Middle East, as in the West or Japan, takes
place only in specific historical circumstances. British and French soldiers
sacrificed their lives in World War I not because of the British character or
the French religion but because of the nature of trench combat; IRA starvations
reflected the politics of Ireland in 1981, not the nature of Celtic culture.
Similarly, suicide bombings in the Middle East result from specific historical
developments, not the permanent verities of Islam.

State Support
What are those developments? The fact that several states, starting with Iran,
now sponsor suicide terrorism. Governments, not individual willing to die, make
this a potent force. Without state support, suicide acts would be infrequent
and ineffectual.

Ayatollah Khomeini claims his radical version of fundamentalist Islam is
suitable for all Muslims. The Iranian Constitution, passed right after the
radical fundamentalists came to power, codifies "trying to perpetuate [the
Islamic] revolution both at home and abroad" as the regime's highest priority.
Tehran initially hoped its example would inspire like-minded Muslims to
overthrow existing governments. It quickly became apparent, however, that
exhortation alone would not suffice. By late 1979 the Iranian leadership
adopted a second approach: it funded and armed subversive efforts throughout
the Muslim world, from Egypt to the Philippines. But the outbreak of war with
Iraq in September 1980, which absorbed nearly all Iran's money and arms, put an
end to this effort. A third tactic was then adopted, one that would spread the
revolution inexpensively: terrorism, specifically suicide terrorism. And,
instead of dissipating their meager resources in many regions, the Iranian
leaders chose to concentrate these in Lebanon, the country that seemed most
likely to see the establishment of an Islamic republic.

The first major instance of suicide terrorism was the December 1981 destruction
of the Iraqi embassy in Beirut, killing 27 and wounding over 100. Suicide
bombing acquired major political importance with the assassination of Bashir
Jumayyil in September 1982; it went international with the bombing of the U.S.
embassy in Beirut in April 1983, killing 63. The largest explosion took place
in October 1983 when a truck bomb killed 241 U.S. servicemen. The unceasing
campaign that took place between 1983 and 1985 against Israeli troops in
southern Lebanon was perhaps its outstanding success, for, unable to cope with
this assault, Israel retreated almost entirely from Lebanon. Suicide bombs have
also gone off in Kuwait, Syria, and many times in Iraq.

The superiority of suicide missions over rival forms of terrorism needs little
emphasis. The eviction of Israeli forces from Lebanon stands in dramatic
contrast to the Arabs' total lack of success in the West Bank and Gaza Strip;
indeed, no one had ever before driven the Israelis out of an area. It is clear
that a person willing to give up his life can adopt measures not available to
someone trying to stay alive. A car bomb destroyed the Israeli military
headquarters in Tyre in November 1983, killing 80 - more casualties than the
PLO had claimed during the previous five years.

Little can be done to deter would-be suicides, especially if they have state
backing. As Secretary of Defense Caspar W. Weinberger noted, "In the final
analysis, if one or two people are prepared to die in the attempt, they can do
a great deal of damage." Although radical fundamentalist Muslims attacked
eleven targets in Kuwait on one day in December 1983, the only strike to have a
real impact was that carried out by a suicide bomber, who blew up the U.S.
embassy.

Iran's effort had such success that the other major sponsors of terrorism in
the Middle East-Qadhdhafi, Asad, and 'Arafat-quickly began to imitate its
methods. (Although Arafat's PLO is not, of course, a government, its financial,
military, and institutional capabilities are closer to that of an established
state than to that of other irredentist movements.) The Iraqis too apparently
adopted suicide terrorism.

Lest there be any doubt that states sponsor the great majority of suicide
missions, the proof is worth noting in some detail.

First, the shadowy nature of the organizations that claim responsibility for
suicide actions points to the involvement of government intelligence
organizations. While terrorist organizations want to become known and feared,
states wish to stay out of the limelight. Doubts about the existence of Islamic
Jihad, an organization first heard of in May 1982 and widely associated with
suicide activities, are in themselves reason to suspect it of being a front for
Iranian intelligence.

Second, the intricacy of plans points to government involvement, for these go
beyond the capabilities of small organizations. Car-bombings against American
and French installations showed enormous sophistication. In almost every case,
the vehicle went unerringly to the most vulnerable spot of the building under
attack. Th


• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: * 11.04.02, 01:40 zarchiwizowany

www.washingtonpost.com/wp-dyn/articles/A27226-2002Apr10.html


• jp IP: *.cm-upc.chello.se
Gość: jp 10.04.02, 00:27 zarchiwizowany

www.astro.city.sendai.jp/


• &# 287;üiiş&# 287;ü&# 287;ü IP: *.cm-upc.chello.se
Gość: .şpğ 09.04.02, 23:57 zarchiwizowany

www.paratype.com/camera/


• U F O IP: *.cm-upc.chello.se
Gość: ufo 09.04.02, 00:29 zarchiwizowany

www.ufoseek.com/
members23.cool.ne.jp/~chinari21/6-1.html
www.counterevidence.com/


• HEADLINES 6.04.2002 IP: *.cm-upc.chello.se
Gość: INFO 07.04.02, 00:23 zarchiwizowany

Saturday, April 6, 2002


HEADLINES

Israeli Warplanes and Artillery in Action in S. Lebanon
Saturday Night After Direct Hizballah Hit on
Divided Border Village Ghajar Injures Three Children –
One 3-Year Old Girl Seriously

Shelling and Anti-Tank Fire from Lebanon, Saturdays
Second Attack, Sweeps Length of Frontier
Israel Air Force Chief Halutz: Odds Up of
Second Front Opening up in North
Continuing Shelling and Rocket Attacks from Lebanon
Prompt Heavy Israeli Troop Buildup on Northern
Frontier and High State of Preparedness


DEBKAfile’s Security Sources: Hizballah Partnered in Latest Attacks by
al Qaeda Elements and Hardline PFLP-GC Militants


Senior US Security Sources:
Syria’s Main Missile and Chemical Weapons Facility at
Homs Blown up in Mysterious Explosions on March 24
North Koreans Among Tens of Engineers and Technicians
Killed in Underground Plant
Factory Manufactured Scud-C and Scud-D, Liquid and
Solid Fuels, Chemical Warheads, Oxidizers

Syrians Suspect Israeli Undercover Saboteurs Struck in Reprisal for
Syrian Military Intelligence Aid in Terrorist
Hit against Galilee Highway on March 12 -
Or US Reprisal for Free al Qaeda Transit through Syria
In Texas, Bush and Blair Underline Saddam Menace But
Fail to Agree on Military Measures to Oust Him
US President on Arafat: “He Has Failed in Leadership,
Never Performed, or Lived up to His Promises and I’m Disappointed”
As Israel Presses on with Military Advance against
Palestinian Terrorist Strongholds, White House
Spokesman Fleischer Tells Reporters Israel Needs Time
to Digest What Bush Expects: “Major Events Don’t
Happen Overnight”.
Secretary Powell Has No Plans to Meet Arafat
Three Israeli Soldiers Were Killed in Continuing
Intense Fighting in Jenin:
Sgt. Merom Fisher, 19, from Moshav Avigdor
Sgt. Roy Tal, 21, from Maalot
Corp. Oded Kornfein, 20, from Kibbutz Ha’On
Fourth Israeli Soldier Killed, Master Sgt. Nitsan Avraham, 22, from
Lod, and Three Israelis Wounded in Clash with
Palestinian Infiltrators in Rafah-Yam, S. Gaza Strip
Infiltrators Killed
Palestinians Report at Least 35 Dead in Jenin and
Nablus Since Friday - Among them Senior Commanders of
Hamas and Al Aqsa Brigades, Qais Idwan and Nasser Aweis
Iranian Leader Khamenei Calls for One-Month
Oil Embargo Against Pro-Israeli Western Nations



• I Z R A E L IP: *.cm-upc.chello.se
Gość: drf 05.04.02, 19:35 zarchiwizowany

www.israelinsider.com/index.htm
www.israelinsider.com/views/articles/views_0117.htm
www.israelinsider.com/channels/politics/main/index.htm


I don't understand
By Naomi Ragen March 12, 2002

I don't understand why people are still listening to Shimon Peres. Everything
he has said, every idea he has had, has turned out to be a complete disastrous
mistake. Why is this man still talking? But most importantly, why are we still
listening?
I don't understand why people say there is no military solution. When people
are using arms to murder you, the only solution, other than dying, is a
military solution. It's called a war. The people that make it impossible for
the other side to kill them and their children are called the victors. There
isn't any way out of this. If people are throwing bad words at you, you can sit
down and talk to them, try to convince them you are right, try to compromise.
But when they are throwing grenades, that's a military problem, which only has
a military solution.

I don't understand why people say: "There is no solution. There doesn't seem to
be anyone on the other side to talk to." Hello? Who says you have to talk? Who
says that talking always leads to solutions? Remember Hitler? Remember
Chamberlain? Remember all the talking that went on before Hitler invaded
Poland? When there is no one to talk to on the other side and they are invading
you and trying to kill you, that doesn't mean there is no solution. It means
you need to wipe out the other side, or hurt them enough to convince them to
accept your solution.

I don't understand why people keep saying they don't want to let our soldiers
fight because things will just get worse. No. If our soldiers are allowed to
fight, things will just get better.

I don't understand Jewish idiots who have targeted Arab schoolchildren in some
moronic revenge attack. We don't want, or need, revenge. We need security.
Revenge that has no security goal is not only evil, it's a stupid waste of time
and energy. I don't want them to die. I want us to live. If the former isn't
connected to the latter, there's no point.

I don't understand Jews who are still reading Michael Lerner's Tikkun Magazine
of Jewish self-hatred. The man has been actively supporting Arab terror
sympathizers and maligning the Jewish homeland for the entire existence of his
dismal little rag. Any Jew who subscribes, who invites this person to air his
sickening agenda at his organization, synagogue, or community center might as
well send his money directly to Yasser and cut out the Yiddel in the middle.

I don't understand Ariel Sharon who knows what he has to do, but instead
prefers to flatten empty buildings. Mr. Sharon, fight, or retire and let those
who have the heart to do what must be done take over. Arrest Yasser and put him
on trial, nullify Oslo, retake the West Bank and Gaza, jail the inciters,
deport the terrorists. Stop posturing, and put an end to the grave digging for
Israeli children. The people are not strong. The people are fed up.



• P E S A C H IP: *.cm-upc.chello.se
Gość: d 03.04.02, 17:55 zarchiwizowany

www.vbm-torah.org/pesach.htm


• www.israelnationalnews.com IP: *.cm-upc.chello.se
Gość: ! 03.04.02, 03:34 zarchiwizowany

www.israelnationalnews.com/metafiles/asx/israelnationalradio.asx


• ..........................................dyskusja IP: *.cm-upc.chello.se
Gość: * 30.03.02, 13:12 zarchiwizowany

(Aquarion) You really arn't going to like this, but...
*** Aquarion (na@aquarion.demon.co.uk) changed mode: +m
Aquarion waits for the screaming to die down a bit.
(Aquarion) Okay, Meetings need to be a little less random. Hence the attempt
at moderation to find out if it's going to work
(Aquarion) ThomCor (Which sounds like some kind of Supermegacorperation, but I
digress) has a status report, and so does maaike, so I'll voice them to make
the reports.
*** Aquarion (na@aquarion.demon.co.uk) changed mode: +v ThomCor
(ThomCor) right, okay, so eric, thomas and myself (myself currently being
thom) met in london this thursday
(Aquarion) Now, have you anything you want to say to the class?
(ThomCor) we were there to discuss an overall vision for the movie.
(ThomCor) we decided a few things - mainly that we needed more concrete plans
in order to decide anything.
(ThomCor) we are all coming at the script from different angles, but have a
general workable vision. now we need to be able to set shooting dates, so we
need locations.
(ThomCor) we also ate pizza. it was quite nice.
(ThomCor) er.
(ThomCor) the end,
(ThomCor) probably.
(Aquarion) If anyone has any questions about the status reports, message them
to either me or CorThom
(Aquarion) Okay then
*** Aquarion (na@aquarion.demon.co.uk) changed mode: -v ThomCor
(Aquarion) A minor explaination, then, for how this is going to work:
(Aquarion) (Since people have been asking me)
(Aquarion) On a Moderated Channel, only Operators and people with Voice can
speak
*** Oliver_ (fm01cch@molnir.brunel.ac.uk) joined the channel
(Aquarion) At this point, I have Ops, and have just taken voice away from Cor
& Thom.
(Aquarion) Anything you say won't appear in the main channel
*** Simon (~simon@firecloud.plus.com) joined the channel
(Aquarion) This will last for anything that is an announcement, and is not
around for discussion, for reasons that will be explained in item two :-)
(Aquarion) If any of the people who have just joined us have status reports,
could they msg me telling me so (Not the reports themselves, just the fact you
have a report)
(Aquarion) by /msg ing me.
(Aquarion) Okay, maaike's Status report then:
*** Aquarion (na@aquarion.demon.co.uk) changed mode: +v maaike
(Aquarion) maaike?
(maaike) I've just been looking through afpmeet reports, trying to put faces
to actors' names so any more costume designs will look vaguely like they're
being worn by whoever should be wearing them
(maaike) (on the side, hippo, I've found exactly one picture of you and your
face isn't too clear; it's from ccde
(maaike) also, I've started drawing Salzella sans chicken suit
(maaike) that's, uh, everything.
(Aquarion) Okay, everybody give him a big round of applause...
(maaike) him?
(Aquarion) Sorry :)
(maaike) :-)
*** Aquarion (na@aquarion.demon.co.uk) changed mode: -v maaike
(Aquarion) Right. Next bit then.
(Aquarion) The next item translates into Real Language as "Not Comittees",
which would have been nicer if I'd spelt it right.
*** Aquarion (na@aquarion.demon.co.uk) changed mode: +v ThomCor
*** Kincaid (~Karl@modem-1873.orangutan.dialup.pol.co.uk) joined the channel
(ThomCor) *koff*
(Aquarion) Basically, This is the reason for this moderatedness. In thirty-
four meetings, over thirty six weeks
ThomCor taps the mic
(Aquarion) we've managed to get a script and a club.
(ThomCor) we have achieved little.
*** Joy (...@210-54-228-86.dialup.xtra.co.nz) joined the channel
(Aquarion) Part of the reason for this (It has been decided) has been that
everything that is being done is being pedanted and picked apart without any
actual constructive help being given.
(Aquarion) or "Being Put In A Committee" as it's commonly known.
*** Joy (...@210-54-228-86.dialup.xtra.co.nz) left the channel
*** Oliver_ (fm01cch@molnir.brunel.ac.uk) left the channel
(ThomCor) basically, when people work alone to Get Stuff Done, stuff gets
done.
(ThomCor) when people work in groups of about 5, nothing happens.
(ThomCor) because of the arguing.
(Aquarion) So the proposed system is to have *one* person for each job, and
only the things they think should be discussed get opened up for discussion
(ThomCor) so, we essentially need to appoint individuals, let them get on
with it, then report back on sundays. reports should not be open for
discussion, unless the reporter asks for it.
(Aquarion) ...hence the +m on the channel for status reports.
(Aquarion) This is a status report, because it's what The Cabal have been
arguing about all week :-)
(ThomCor) most vociferously.
(ThomCor) there should be less of us.
(Aquarion) Simon said that the reporters need to be accountable to someone,
(Aquarion) And that's why I left the pause at the end of the stat reports for
any questions
(Aquarion) this isn't discussion, it's the designated persons /job/ to do
things. If they have to justify everything to the nth degree, nothing will get
done.
(Aquarion) Again.
(ThomCor) the floor needs to be open at the end of each item
(ThomCor) when conversation dies, that's when the next moderated item should
be done
(Aquarion) No, that's the same as it has been before
*** Aquarion (na@aquarion.demon.co.uk) changed mode: -m
(CorThom) thanks
(CorThom) then allot a time afterwards
(CorThom) some people are new to irc, they might not even know how to /msg
(Aquarion) Every action, or proposed action, has been discussed into
insignificance before it's even been done
(Aquarion) (we are now unmoderated, btw. Feel free to chime in)
(Simon) I had to ask when I arrived today... I suggest a set time limit
after each report. This might hopefully get people to stick to questions of the
reporter, rather than rambling discussion.
(CorThom) the job of the moderator is to stop the rambling, not cease
conversation entirely
(Needle) or have an alternative channel where such things can be discussed
at the same time
(lonecat) that would rather defeat the object?
(Aquarion) Needle: That doesn't really work, it just means everything gets
discussed to death there instead of here
(Simon) rather than hard moderation, how about simply a chair who says "OK,
enough"? Depends if he'd prepared not to be too polite...
(CorThom) aqua: then you stop them getting discussed to death. Don't stop
them getting discussed at all.
(CorThom) simon: yep
(Simon) (I'm talking after reports. I agree on uninturrupted reports)
(Aquarion) Simon: Stoping discussion on #movie is uneasy.
(CorThom) aqua: he's right, really.
(Aquarion) Every argument disintergrates into five subarguments, three of
which may be valid
(maaike) brb, cat wants in/food
(Aquarion) but the reporter is only trying to fight one
(CorThom) aqua: you implementing this was a bit sudden, and without much
consulatation, we really should have known what to expect.
(Aquarion) That's why I proposed the questions thing.
(Simon) So we need a forceful chair who'll say "Folks, can we discuss THIS
first"
(Aquarion) And that's exactly my point. I am now defending my decision against
two differant attacks :-)
(Aquarion) Simon: There are people here who Don't Listen, because Their
Argument is More Important.
(Simon) True, OK... two points
(CorThom) aqua: two? I only see consensus here, myself
(Simon) 1. Have questiosn through moderator, so only one question is
discussed at once. I don't know IRC well do I don't know how feasible
(Aquarion) CorThom: That's because you are one of the attackers.
(Simon) 2. Why do we need IRC? If discussion is a bad thing (and I agree on
that in its current form), why not just use the mailing list, where more people
can be involved without getting bogged down?
(Aquarion) Simon: That's exactly wh


• Re: Woda swieconej i kropidla wam trzeba (notxt) IP: *.cm-upc.chello.se
Gość: * 19.03.02, 18:52 zarchiwizowany

sceptyk napisał(a): www.fake.zet.osiedle.pl/marynarz.htm




• Woda swieconej i kropidla wam trzeba (notxt)
sceptyk 15.03.02, 00:31 zarchiwizowany



• Jedenascie plus dwa i dwanascie plus jeden IP: *.cm-upc.chello.se
Gość: 13 15.03.02, 00:11 zarchiwizowany

The smallest Permutable prime.
____________________________________________________________________________
ELEVEN + TWO = TWELVE + ONE is an anagrammatical equation involving 13.
___________________________________________________________________________
13 is the smallest prime which is the sum of two distinct prime squares (2*2 +
3*2).
_____________________________________________________________________________

13*2 = 169 and (reversing all digits) 31*2 = 961.


• 73
zupagrzybowa 12.03.02, 23:41 zarchiwizowany

Liczba pierwsza , ciekawa...


• Re: 1970-2070 PRIME YEARS
zupagrzybowa 12.03.02, 23:28 zarchiwizowany

Gość portalu: PRIM napisał(a):

> 1973
> 1979
> 1987
> 1993
> 1997
> 1999
> 2003
> 2011
> 2017
> 2027
> 2029
> 2039
> 2053
> 2063
> 2069
> PRIME YEAR = NEW QUALITY AND COMPOSED YEAR
> IN LIFE PRIMES
> YEAR 3
> 5
> 7
> 11
> 13
> 17
> 19
> 23
> 29
> 31
> 37
> 41
> 43
> 47
> 53
> 59
> 61
> 67
> 71
> 73
> 79
> 83
> 89
> 97
> 101
> 103
> 107
> 109
> 113
> 127
> 131
____________________________________________________________________
Lata Pierwsze i zlozone

1901=*
1907= *
1913=*
1914=2.3.11.29
1915=5.383
1916=2.2.479
1917=3.3.3.71
1918=2.7.137
1919=19.101
1920=2.2.2.2.2.2.2.3.5
1921=17.113
1922=2.31.31
1923=3.641
1924=2.2.13.37
1925=5.5.7.11
1926=2.3.3.107
1927=41.47
1928=2.2.2.241
1929=3.643
1930=2.5.193
1931=*
1932=2.2.3.7.23
1933=*
1934=2.967
1935=5.397
1936=2.2.2.2.11.11
1937=13.149
1938=2.3.17.19
1939=7.277
1940=2.2.5.97
1941=3.647
1942=2.971
1943=29.67
1944=2.2.2.3.3.3.3.3
1945=5.389
1946=2.7.139
1947=3.11.59
1948=2.2.487

1949=*

1950=2.3.5.5.13
1951=*
1952=2.2.2.2.2.61
1953=3.3.7.31
1954=2.977
1955=5.17.23
1956=2.2.3.163
1957=19.103
1958=2.11.89
1959=3.653
1960=2.2.2.5.7.7
1961=37.53
1962=2.3.3.109
1963=13.151
1964=2.2.491
1965=5.3.131
1966=2.983
1967=7.281
1968=2.2.2.2.3.41
1969=11.179
1970=2.5.197
1971=3.3.3.73
1972=2.2.17.29
1973=*
1974=2.3.7.47
1975=5.5.79
1976=2.2.2.13.19
1977=3.659
1978=2.23.43
1979=*
1980=2.2.3.3.5.11
1981=7.283
1982=2.991
1987=*
1988=2.2.7.71
1989=3.3.13.17
1990=2.5.199
1991=11.181
1993=*
1994=997.2
1995=5.3.7.19
1996=2.2.499
1997=*
1998=2.3.3.11.37
1999=*
2000=2.2.2.2.5.5.5
2001=3.23.29
2002=2.7.11.13
2003=*
2004=2.2.3.167
2005=5.401
2006=2.17.59
2007=3.3.223
2008=2.2.2.251
2009=7.7.41
2010=2.3.5.67




• 1970-2070 PRIME YEARS IP: *.cm-upc.chello.se
Gość: PRIM 11.03.02, 03:24 zarchiwizowany

1973
1979
1987
1993
1997
1999
2003
2011
2017
2027
2029
2039
2053
2063
2069
PRIME YEAR = NEW QUALITY AND COMPOSED YEAR
IN LIFE PRIMES
YEAR 3
5
7
11
13
17
19
23
29
31
37
41
43
47
53
59
61
67
71
73
79
83
89
97
101
103
107
109
113
127
131


• 1970
zupagrzybowa 10.03.02, 22:10 zarchiwizowany

1970
2.5.197


• 69 IP: *.cm-upc.chello.se
Gość: 69 10.03.02, 11:36 zarchiwizowany

69
23.3


• 19 IP: *.cm-upc.chello.se
Gość: 68 10.03.02, 10:30 zarchiwizowany

68
17.2.2


• 67 IP: *.cm-upc.chello.se
Gość: 67 10.03.02, 09:34 zarchiwizowany

GOD BLESS PRIM67 !


• 66 IP: *.cm-upc.chello.se
Gość: 66 10.03.02, 05:39 zarchiwizowany

66
2.3.11


• ................................alt.pl.konspiracja IP: *.cm-upc.chello.se
Gość: X 09.03.02, 15:58 zarchiwizowany

groups.google.com/groups?hl=sv&group=alt.pl.konspiracja


• [...] IP: *.cm-upc.chello.se
Gość: ! 09.03.02, 01:15 zarchiwizowany

Wiadomość została usunięta ze względu na złamanie prawa lub regulaminu.


• Dla przypomnienia: GWIAZDA PRZEWODNIA ? IP: *.cm-upc.chello.se
Gość: ZN*NZ 07.03.02, 23:41 zarchiwizowany

www.stel.ru/stalin/joseph_1935-1953.htm


• Hamas &# 8211; The Islamic Resistance Movement IP: *.cm-upc.chello.se
Gość: arabic 06.03.02, 02:39 zarchiwizowany

www.ajc.org/Terrorism/BriefingsDetail.asp?did=221&pid=1055


• SLD IP: *.cm-upc.chello.se
Gość: -------- 04.03.02, 22:26 zarchiwizowany

www.erowid.org/chemicals/lsd/lsd_effects1.shtml


• talmud IP: *.cm-upc.chello.se
Gość: -------- 03.03.02, 19:04 zarchiwizowany

www.us-israel.org/jsource/loc/talmudtoc.html


• zazensex? IP: *.cm-upc.chello.se
Gość: (=) 01.03.02, 22:32 zarchiwizowany

www.zazensex.com/


• Fizyka kwantowa...... IP: *.cm-upc.chello.se
Gość: Shiva 28.02.02, 20:37 zarchiwizowany

www.hinduism.co.za/newpage1.htm


• Was the Kaaba Originally a Hindu Temple?
zupagrzybowa 28.02.02, 03:38 zarchiwizowany

www.hinduism.co.za/kaabaa.htm


Was the Kaaba Originally a Hindu Temple?
By P.N. Oak (Historian)

Glancing through some research material recently, I was pleasantly surprised to
come across a reference to a king Vikramaditya inscription found in the Kaaba
in Mecca proving beyond doubt that the Arabian Peninsula formed a part of his
Indian Empire.

The text of the crucial Vikramaditya inscription, found inscribed on a gold
dish hung inside the Kaaba shrine in Mecca, is found recorded on page 315 of a
volume known as ‘Sayar-ul-Okul’ treasured in the Makhtab-e-Sultania library in
Istanbul, Turkey. Rendered in free English the inscription says:

"Fortunate are those who were born (and lived) during king Vikram’s reign. He
was a noble, generous dutiful ruler, devoted to the welfare of his subjects.
But at that time we Arabs, oblivious of God, were lost in sensual pleasures.
Plotting and torture were rampant. The darkness of ignorance had enveloped our
country. Like the lamb struggling for her life in the cruel paws of a wolf we
Arabs were caught up in ignorance. The entire country was enveloped in a
darkness so intense as on a new moon night. But the present dawn and pleasant
sunshine of education is the result of the favour of the noble king
Vikramaditya whose benevolent supervision did not lose sight of us- foreigners
as we were. He spread his sacred religion amongst us and sent scholars whose
brilliance shone like that of the sun from his country to ours. These scholars
and preceptors through whose benevolence we were once again made cognisant of
the presence of God, introduced to His sacred existence and put on the road of
Truth, had come to our country to preach their religion and impart education at
king Vikramaditya’s behest."

For those who would like to read the Arabic wording I reproduce it hereunder in
Roman script:

"Itrashaphai Santu Ibikramatul Phahalameen Karimun Yartapheeha Wayosassaru
Bihillahaya Samaini Ela Motakabberen Sihillaha Yuhee Quid min howa Yapakhara
phajjal asari nahone osirom bayjayhalem. Yundan blabin Kajan blnaya khtoryaha
sadunya kanateph netephi bejehalin Atadari bilamasa- rateen phakef tasabuhu
kaunnieja majekaralhada walador. As hmiman burukankad toluho watastaru hihila
Yakajibaymana balay kulk amarena phaneya jaunabilamary Bikramatum".

(Page 315 Sayar-ul-okul).

[Note: The title ‘Saya-ul-okul’ signifies memorable words.]

A careful analysis of the above inscription enables us to draw the following
conclusions:

That the ancient Indian empires may have extended up to the eastern boundaries
of Arabia until Vikramaditya and that it was he who for the first time
conquered Arabia. Because the inscription says that king Vikram who dispelled
the darkness of ignorance from Arabia.
That, whatever their earlier faith, King Vikrama’s preachers had succeeded in
spreading the Vedic (based on the Vedas, the Hindu sacred scriptures)) way of
life in Arabia.
That the knowledge of Indian arts and sciences was imparted by Indians to the
Arabs directly by founding schools, academies and cultural centres. The belief,
therefore, that visiting Arabs conveyed that knowledge to their own lands
through their own indefatigable efforts and scholarship is unfounded.
An ancillary conclusion could be that the so-called Kutub Minar (in Delhi,
India) could well be king Vikramadiya’s tower commemorating his conquest of
Arabia. This conclusion is strengthened by two pointers. Firstly, the
inscription on the iron pillar near the so-called Kutub Minar refers to the
marriage of the victorious king Vikramaditya to the princess of Balhika. This
Balhika is none other than the Balkh region in West Asia. It could be that
Arabia was wrestled by king Vikramaditya from the ruler of Balkh who concluded
a treaty by giving his daughter in marriage to the victor. Secondly, the
township adjoining the so called Kutub Minar is named Mehrauli after Mihira who
was the renowned astronomer-mathematician of king Vikram’s court. Mehrauli is
the corrupt form of Sanskrit ‘Mihira-Awali’ signifying a row of houses raised
for Mihira and his helpers and assistants working on astronomical observations
made from the tower.

Having seen the far reaching and history shaking implications of the Arabic
inscription concerning king Vikrama, we shall now piece together the story of
its find. How it came to be recorded and hung in the Kaaba in Mecca. What are
the other proofs reinforcing the belief that Arabs were once followers of the
Indian Vedic way of life and that tranquillity and education were ushered into
Arabia by king Vikramaditya’s scholars, educationists from an uneasy period
of "ignorance and turmoil" mentioned in the inscription.

In Istanbul, Turkey, there is a famous library called Makhatab-e-Sultania,
which is reputed to have the largest collection of ancient West Asian
literature. In the Arabic section of that library is an anthology of ancient
Arabic poetry. That anthology was compiled from an earlier work in A.D. 1742
under the orders of the Turkish ruler Sultan Salim.

The pages of that volume are of Hareer – a kind of silk used for writing on.
Each page has a decorative gilded border. That anthology is known as Sayar-ul-
Okul. It is divided into three parts. The first part contains biographic
details and the poetic compositions of pre-Islamic Arabian poets. The second
part embodies accounts and verses of poets of the period beginning just after
prophet Mohammad’s times, up to the end of the Banee-Um-Mayya dynasty. The
third part deals with later poets up to the end of Khalif Harun-al-Rashid’s
times.

Abu Amir Asamai, an Arabian bard who was the poet Laureate of Harun-al-Rashid’s
court, has compiled and edited the anthology.

The first modern edition of ‘Sayar-ul-Okul’ was printed and published in Berlin
in 1864. A subsequent edition is the one published in Beirut in 1932.

The collection is regarded as the most important and authoritative anthology of
ancient Arabic poetry. It throws considerable light on the social life,
customs, manners and entertainment modes of ancient Arabia. The book also
contains an elaborate description of the ancient shrine of Mecca, the town and
the annual fair known as OKAJ which used to be held every year around the Kaaba
temple in Mecca. This should convince readers that the annual haj of the
Muslims to the Kaaba is of earlier pre-Islamic congregation.

But the OKAJ fair was far from a carnival. It provided a forum for the elite
and the learned to discuss the social, religious, political, literary and other
aspects of the Vedic culture then pervading Arabia. ‘Sayar-ul-Okul’ asserts
that the conclusion reached at those discussions were widely respected
throughout Arabia. Mecca, therefore, followed the Varanasi tradition (of India)
of providing a venue for important discussions among the learned while the
masses congregated there for spiritual bliss. The principal shrines at both
Varanasi in India and at Mecca in Arvasthan (Arabia) were Siva temples. Even to
this day ancient Mahadev (Siva) emblems can be seen. It is the Shankara (Siva)
stone that Muslim pilgrims reverently touch and kiss in the Kaaba.



• PURIM IP: *.cm-upc.chello.se
Gość: LOL 26.02.02, 16:21 zarchiwizowany

www.cyber-kitchen.com/holidays/purim/recipes.htm

www.ou.org/publications/ja/5758/slice.htm


www.holidays.net/purim/

www.web-holidays.com/purim/


www.vbm-torah.org/purim.htm


www.613.org/purim.html


• CARPE DIEM !!! |notext| IP: *.cm-upc.chello.se
Gość: DrF 24.02.02, 18:42 zarchiwizowany



• HippiTime@2002 IP: *.cm-upc.chello.se
Gość: Y 22.02.02, 16:07 zarchiwizowany

www.users.cloud9.net/~kgeary/
www.shrifreedom.com/YogaHealingArts.htm
members.aol.com/fraglthndr/
www.allonetribedrum.com/
www.saber.net/~tsgunn/
www.saber.net/~tsgunn/home.html
www.angelfire.com/az/dotshome/index.html

...........................................


What People Are Saying About The Urantia Book...(???)

It (The URANTIA Book) has, with its revelations, not only captivated me, but
changed my outlook and gave me after a lifelong search the conviction of
having, at last, found the Truth. -- Goslar, GERMANY

This is an excellent book because it presents in depth (form & content) the
mutual relations between the science, philosophy and religion on a universal
scale. -- Plovdiv, BULGARIA

Many tears fell on the Book while reading the emotional parts. -- Heusden,
NETHERLANDS

The URANTIA Book has been part of my life for a good 20 years. The URANTIA Book
is not a Holy Book but its teachings given, little by little, in wisdom will
draw us closer to each other. -- San Diego, California, U.S.A.

Six years ago I had the pleasure of receiving a copy of The URANTIA Book which
contains a wealth of enlightening information and obviously, can be regarded as
a meritorious literary work. -- Estado de Mexico, MEXICO

I am, with great awe, reading for the first time, The URANTIA Book. It answers
many, many questions that I have had throughout my life. -- Kula, Hawaii U.S.A.

I have been studying The URANTIA Book and have found it the most conclusive and
inspiring book on our existence. -- Lake Geneva, Illinois, U.S.A.

I have been appreciating "The Book" for many years. And I do wish to thank all
that are helping to share it with others. -- Chonburi, THAILAND


Pozdrawia drf


• Rainbow IP: *.cm-upc.chello.se
Gość: i 21.02.02, 20:16 zarchiwizowany

www.welcomehome.org/rainbow/related.html


• cam IP: *.wroclaw.sdi.tpnet.pl
Gość: Vist¸ 18.02.02, 18:46 zarchiwizowany

Gość portalu: wwwcam napisał(a):

> www.exibir.com/

oki :-)

Ale sam wiesz...
Tu potrzebny jest piękny, dziki, tropicalny widok full screen... dla oddechu

a nie pocztowe znaczki...

thanx

Vist¸____________/


• Como usar esta RobotCam IP: *.cm-upc.chello.se
Gość: wwwcam 18.02.02, 18:33 zarchiwizowany

www.exibir.com/


• cam... IP: *.wroclaw.sdi.tpnet.pl
Gość: Vist¸ 18.02.02, 02:50 zarchiwizowany

Gość portalu: webcam napisał(a):

www.evilcindy.com/cindycam.asp

Daj ładny webcam z tropików. o.k. ?


• california IP: *.cm-upc.chello.se
Gość: webcam 18.02.02, 02:45 zarchiwizowany

www.evilcindy.com/cindycam.asp



• Re: ______________________FractalArt IP: *.cm-upc.chello.se
Gość: ! 17.02.02, 02:30 zarchiwizowany

aoo.freeservers.com/cgi-bin/i/images/028_secondring.jpg


• USA GA Savannah webcam IP: *.cm-upc.chello.se
Gość: webcam 16.02.02, 22:05 zarchiwizowany

www.bitvit.com/Storm/Savannah/savhurri.htm


• SYMULATOR BOGA..... IP: *.cm-upc.chello.se
Gość: *pan* 16.02.02, 01:28 zarchiwizowany

www.jraxis.com/atheism/simulator/


• arafat IP: *.cm-upc.chello.se
Gość: d 03.02.02, 17:36 zarchiwizowany

aoo.freeservers.com/images/arfat.gif


• israelnationalnews IP: *.cm-upc.chello.se
Gość: 0>: 02.02.02, 02:03 zarchiwizowany

www.israelnationalnews.com/metafiles/asx/israelnationalradio.asx


• Re: ______________________Creation IP: *.wroclaw.sdi.tpnet.pl
Gość: Vist¸ 01.02.02, 23:54 zarchiwizowany




www.digitalblasphemy.com/dbgallery/1/creation1024.shtml


• Re: ______________________Fluorescent IP: *.wroclaw.sdi.tpnet.pl
Gość: Vi@tr´ 01.02.02, 23:51 zarchiwizowany





www.digitalblasphemy.com/dbgallery/4/fluorescence6.shtml



• Re: ______________________Thetismoon IP: *.wroclaw.sdi.tpnet.pl
Gość: Vist¸ 01.02.02, 23:45 zarchiwizowany




www.digitalblasphemy.com/dbgallery/3/thetismoon.shtml



• jacek71 IP: *.cm-upc.chello.se
Gość: d 01.02.02, 22:32 zarchiwizowany

Re: No ,coz zbliza sie rozliczenie z palestynskimi terorystami w Izra

autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 07:11:22

Re: No ,coz zbliza sie rozliczenie z palestynskimi terorystami w Izra

autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 07:20:26

zydowski kawaly o polakach
autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 05:21:18

Re: Tel-Aviv? Nie...
autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 19:59:10

Re: NIECH ZYJE IZRAEL !
autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 23:51:51

Re: Oficjalna list Jew Lovers 2001
autor: Gość portalu: jacek71 adres: 64.114.83.*
01-06-2001, 03:17:27

dresiarze/bmw
autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 05:30:07

Re: ZYDOWSKI SPISEK (a nie Miadoszwacznicki!)
autor: Gość portalu: jacek71 adres: 64.114.83.*
01-06-2001, 06:09:02

Oficjalna list Jew Lovers 2001
autor: jacek71
31-05-2001, 02:55:53

Re: Oficjalna list Jew Lovers 2001
autor: Gość portalu: jacek71 adres: 64.114.83.*
01-06-2001, 06:14:4 odp.do paula
autor: Gość portalu: jacek71 adres: 64.114.83.*
01-06-2001, 09:50:11

wojo zyd
autor: Gość portalu: jacek71 adres: 64.114.83.*
01-06-2001, 10:06:51

Re: POLSKA CIERPI przez takich debili jak Jacek71 i szczery ,wstyd
autor: Gość portalu: jacek71 adres: 64.114.83.*
01-06-2001, 19:40:00

Re: Wolnosc dla Palestyny i Palestynczykow!
autor: Gość portalu: jacek71 adres: 64.114.83.*
02-06-2001, 08:47:28

CO ZA SKUR.....NSKI NAROD !!!
autor: Gość portalu: jacek71 adres: 64.114.83.*
31-05-2001, 06:37:47

Odpowiedz do Besciaka
autor: Gość portalu: jacek71 adres: 64.114.83.*
04-06-2001, 00:09:23

Re: Odpowiedz do Besciaka
autor: Gość portalu: jacek71 adres: 64.114.83.*
04-06-2001, 00:30:18

Re: A co po-Jedwabnem
autor: Gość portalu: jacek71 adres: 64.114.83.*
04-06-2001, 01:15:04

Re: Ilosc ofiar arabskiego zamachu wzrosla do 20 zabitych----jednocze

autor: Gość portalu: jacek71 adres: 64.114.83.*
04-06-2001, 06:34:18

wojo,jeden z wielu wybitnych zydow
autor: Gość portalu: jacek71 adres: 64.114.83.*
04-06-2001, 20:41:47





• Toruń ______________________? IP: *.cm-upc.chello.se
Gość: webcam 01.02.02, 01:26 zarchiwizowany

www.123cam.com/site.php?site=http://217.97.134.62/view/view.shtml



• Re: ..............................................Gify IP: *.cm-upc.chello.se
Gość: -------- 28.01.02, 01:35 zarchiwizowany

www.bh.org.il/Images/f-anim.gif


• www.virtualjerusalem.com IP: *.cm-upc.chello.se
Gość: -------- 28.01.02, 01:16 zarchiwizowany

www.virtualjerusalem.com/
www.virtualjerusalem.com/sendaprayer/
forums.virtualjerusalem.com/messages/43/43.html?1012077726


• Prasa arabska IP: *.cm-upc.chello.se
Gość: ;▄▄▄▄█ 27.01.02, 18:58 zarchiwizowany

Special Report January 08, 2002
A New Antisemitic Myth in the Arab Press: The September 11 Attacks Were
Perpetrated by the Jews

Introduction:
Since September 11, the Arab media have claimed that Jews perpetrated the
terrorist attacks on New York City and Washington, D.C. Promoting this new myth
are high-ranking public officials and columnists in the government and non-
government press in Arab countries.

In an attempt to deflect blame from the Arab-Muslim suspects in the attacks,
the media have floated a number of ideas on the identities of the perpetrators.
According to Arab perceptions, the attacks were carried out by those who stood
to gain the most from them. Also examined was the question of who had the
capability to carry out such an operation.

In the articles reviewed in this report, the conclusions point directly at the
Jews. These conclusions are supported by various forms of evidence, further
buttressed by timeworn, long-"substantiated" antisemitic myths. Thus, the
papers posit guilt, substantiate their accusations, convict, and, in one case,
hand down a sentence – annihilation "as Hitler did."

I: Arabs Didn't Do It; All Evidence Against them is False
Many columnists in the Arab press disregarded FBI and media reports concerning
the identities of the perpetrators, stolidly maintaining that no Arab was
responsible. Raed Salah, the head of the Islamic Movement in Israel, wrote in
the movement's mouthpiece Saut Al-Haqq Wa-Al-Hurriyya that it was puzzling
that "the manifests of the two airlines, American Airlines and United Airlines,
whose planes crashed into the Pentagon and World Trade Center, included not a
single Arab… Yet three days later the FBI released the names of 19 Arab
passengers, claming that they were the hijackers of the four planes."[1]

Palestinian columnist Khalil Al-Sawahri wrote in the Palestinian Authority-
sponsored daily Al-Ayyam that the letter left by the hijackers was forged. "Its
disseminators are the circles of Orientalists who are making efforts to tarnish
the image of the Arab Muslim. [They] began with falsifying history, deceitfully
falsifying and attributing to themselves the stories of prophecy [and later
Islamic history] and [continued with] modern films, particularly American
[films] in which Hollywood made an effort to present [Arabs] as thieves,
terrorists, bandits, base, dirty, and so on…"

"The [security] apparatuses that faked the contents of the black box of the
Egyptian plane downed [in October 1999] off the coast of New York, and turned
Captain Al-Batouti into a suicide attacker are the same ones [now] claiming
that the black boxes of the other planes [of the September 11 attacks] were
destroyed and burned – yet at the same time, they claim that they found letters
[left by the terrorists] 'safe and sound.'"

"Furthermore, the will found in the luggage of the Egyptian Muhammad Atta was
obviously forged – how can a man planning to blow himself up in an operation
that will fuse iron and stone focus his will on the handling of his body and
rituals for washing it, when he knows that his body will turn to ashes and be
scattered all over…"[2]

II: The Non-Arab Potential Suspects
Dismissing the possibility that Arabs carried out the attack did not satisfy
some of the writers quoted here, and many offered their own lists of suspects.
Al-Ayyam columnist Tallal 'Ouqal, of the Popular Front for the Liberation of
Palestine (PFLP), suggested that the Americans look "far from the Middle East,"
writing: "…Why can't the motive be a settling of historical accounts from World
War II? Why can't the background [of the attack] be protest by those harmed by
globalization; we noticed the strengthening of the spirit of their battle in
Seattle, Genoa, and Athens…? Why can't the motive be linked to those harmed by
the missile defense system?"[3]

In the same vein, columnist Abd Al-Jabbar 'Adwan wrote in the Saudi-owned
Arabic-language London daily Al-Sharq Al-Awsat: "…It is known that the American
government intends to push forward the missile defense shield project. China,
Russia, and several other European states are opposed to this, and President
Bush is not interested in their position…"[4]

Columnist Hassan M. Yussef wrote in the Syrian government daily
Teshreen: "There is a possibility that this was an [act of] ancient
retribution… The U.S. declared war on Japan—and used the atomic bomb for the
first time against Hiroshima and Nagasaki. [The bomb] killed more than 221,983
Japanese, and was the cause of the Japanese defeat and the end of the war in
1945."[5]

Some pointed their fingers at the American administration itself. For example,
Al-Sharq Al-Awsat columnist Samir 'Atallah raised the possibility that the
attacks on the U.S. were the product of a conspiracy led by President George W.
Bush, explaining his reasoning as follows: "George W. Bush was the president
who garnered the least support of all U.S. presidents throughout history. He
won the election by a miniscule majority that would not have won a village
council [position] in southern Egypt. His presidency was in doubt from the
beginning. It was said that the poor way in which he entered the White House
would divide the American nation. It was said that he is not worthy [of being
president], that he is a man who takes no interest in what is happening in the
world, a man who does not know the name of the president of Pakistan…"

"[But] after September 11, George W. Bush is the first president since
Roosevelt with both parties behind him, with no one opposing him. He is the
first president in the history of the U.S. to have received an unprecedented
amount of financial, political, and military support, and to have it approved
so quickly by Congress…"[6]

The Jerusalem Arabic weekly Al-Manar ran an article by Dr. Abdallah Al-Sheikh,
in which the author claimed that the CIA and FBI were responsible for the
September 11 attacks. Al-Sheikh offered the following evidence: "As is known,
over time, the American security apparatuses turned into mighty institutions
with influence in the political, economic, social, and scientific echelons, and
they cannot be ignored. Similarly, they formed liaisons according to the so-
called survival model, or the bureaucratic model. This model states that after
the establishment of an institution – and primarily an American security
institution – the first priority is survival, even if this leads it to
cooperate with Satan. This is the dominant model in the most powerful
intelligence apparatuses in the world, headed by the American CIA and FBI… The
operation itself [i.e. the attacks] is characteristic of operations by these
apparatuses."[7]

Columnist Mussa Hawamdeh, writing in the Jordanian government daily Al-Dustour,
stated, "… We all know that there are extremist religious groups in the U.S.
who believe that the coming of the Messiah is near, and who aspire to purify
Americans of all their human crimes. Among them are those who believe in
committing suicide in order to reach Paradise, through punishing the human
race. Mass suicide of entire groups has already occurred."[8]

However, the most popular view among the Arab columnists reviewed in this
report is the possibility that Israel, world Zionism, the Mossad, or, simply,
the Jews carried out the attacks.

III: Israel/the Mossad/World Zionism/the Jews Did It
Syrian foreign minister Mustafa Tlass, author of The Matza of Zion, a book that
depicts the infamous Damascus blood libel of 1840 as an actual event, claimed
during a meeting in Damascus with a delegation from the British Royal College
of Defense Studies that the Mossad planned the ramming of tw


• quiddish? IP: *.cm-upc.chello.se
Gość: -------- 24.01.02, 20:32 zarchiwizowany

news.bbc.co.uk/olmedia/1765000/images/_1768059_newman300.jpg


• Re: P R CORPORATION IP: *.cm-upc.chello.se
Gość: drFjord 21.01.02, 01:28 zarchiwizowany

images.flamingtext.com/images/fire.gif


• P R CORPORATION IP: *.cm-upc.chello.se
Gość: DATSH 19.01.02, 07:26 zarchiwizowany

www.123cam.com/site.php?site=http://www.shizuoka.isp.ntt-west.co.jp/wnn-
c/Mt.Fuji-museumE/index-live.html

www.prezydent.pl/dflt/index.php3http://www.123cam.com/site.php?
site=www.sunplus.com/fuji/livee.htm


• Re: jpg IP: *.chello.pl
Gość: kunce 19.01.02, 01:07 zarchiwizowany

Gość portalu: JPG napisał(a):

> a może ta tapeta kunce ?
>
> aoo.freeservers.com/images/n.
> jpg


dzięki, ale z gazety dostęp do rysunków na tym serwerze jest zabroniony


• ........................Karachi czy B ialystok ? IP: *.cm-upc.chello.se
Gość: webcam 19.01.02, 00:53 zarchiwizowany

A LIVE VIEW of Sharah-e-Faisal Karachi as seen from our office window facing
East.

www.instecdigital.com/1/images/colorcam.jpg


• LETTING MYSELF GO IP: *.cm-upc.chello.se
Gość: 1071;R 18.01.02, 19:32 zarchiwizowany

LETTING MYSELF GO - LOSING THE HABITS OF SELF IN THE EVER-PRESENT MOMENT
Stephen Fulder, Ph.D.
Clil Village, Doar Nah Oshrat 25233, Israel
The ego or self does not need to die. It was never there in the first place. So
say many teachers from the non-dual Hindu spiritual tradition as well as
Buddhism. The self, according to this teaching, is a habit born of a life of
conditioning - and more than that, of a more universal karmic causation that
keeps the conditioning process going generation after generation.
It is not that the self is unnecessary. Of course it is necessary given the
nature of human beings. A child grown with an uncertain sense of self can be
very disturbed; an Alzheimer's patient without a memory of self can be
terrified. However though we need it, it may be less solid than we think. Some
spiritually oriented psychologists today are beginning to acknowledge that the
conscious mind may collect around it a self as a survival mechanism: a means to
interpret and relate to the world and thus to negotiate a safe journey through
it. As we rely on it, it has to appear to be solid, trusty and reliable.

In the spiritual path, the self is seen as an obstacle to real knowing. It
contracts consciousness around itself, and prevents us from dissolving in the
sea of global awareness - the cosmic consciousness. The habit of self is
extremely strong; strong enough block this experience of dissolution ('laya')
for almost everybody. The strength of the habit of self lies in the need that
we have to relate to the world from the position of the self; it is continually
reinforced by every thought and experience through which the world is
interpreted. Our fundamental insecurity, which requires us to construct the
self in the first place, supports it by attachments and aversions. Further, the
continual re-inforcing of the self is an unconscious process. Most of the habit
of self lies in the unconscious out of reach of our conscious intention. Indeed
most of our life we simply identify with the self, react from it, but never
actually notice it.

All spiritual practices make the self-process less automatic. Devotion,
suffering and transference on guru or teacher can help to make the self less
dominant. There is a story of a student asking his rabbi why, today, people
cannot see God any more as they used to. He answered 'because today we cannot
stoop so low'. We are caught up in our big self, in the head, and cannot get
underneath it. Another way of looking at this process is one of cleansing; our
contact with the world is contaminated by the self and its need to interpret.
We must purify our perception. As William Blake said: "If the doors of
perception were cleansed, then everything would be seen as it is, infinite."

However the Buddhist and non-dual paths take a rather different approach. There
is no need to climb up the mountain because you are already on the top. In
every moment of perceiving the world, there is already a pure cosmic contact.
The self appears only in the process of recognition and interpretation. This
process of recognition and interpretation requires memory and discursive
thought, and is therefore not in the present moment. The present moment is
essentially self-less, and so the gateway to the wisdom of the infinite. The
loss of self occurs in the moment of true attention. And what is this true
attention? As Krishnamurti says, if you see a snake in your room, that moment
is a moment of true attention! Buddhist practices of awareness require the
practitioner to repeatedly enter a space of being fully present in the moment.
Every thought, every perception, every feeling, is allowed, received, and
acknowledged, without the usual responses and interpretations that are the
essential food of the self-process. Starved of its usual diet of attachments
and aversions, the self-process loosens its grip on perception. Eventually a
more expansive global kind of knowing takes its place.

Living and acting from this panoramic perspective is the joy of spiritual life.



--------------------------------------------------------------------------------


• Re: jpg IP: *.cm-upc.chello.se
Gość: GIF 18.01.02, 18:53 zarchiwizowany

astronomy.swin.edu.au/pbourke/geometry/klein/klein3.gif


• ???? IP: *.cm-upc.chello.se
Gość: 1071;R 18.01.02, 13:27 zarchiwizowany

www.aish.com/seminars/whythejews/index.htm


• ██████████ IP: *.cm-upc.chello.se
Gość: #9608;██ 18.01.02, 02:25 zarchiwizowany

████ ████ ████
████
████ ████
████████████████████████████
███
█ ████
████████████████████████████
███
█ ████ ████
██████████████████████
██████ ████ ████
████
████
████████████████████████████
█████ ███
█ ████
████████████████████████████
███
█ ███ ████
████ ███████████
█████████████████
████ ████ ███
█ ████ ████
██████████████████████
██████ ████ ████
████ ███████
█ ████ ████
████ █████
███████████████████████
████ ████ █
███
████████████████████████████
████ ███
█ ████ ████
██████████████████████
██████ ████ ████
████ █
███
████████████████████████████
████


• Re: jpg IP: *.cm-upc.chello.se
Gość: JPG 18.01.02, 00:26 zarchiwizowany

Gość portalu: wild napisał(a):

> Gość portalu: kunce napisał(a):
>
> > Gość portalu: JPG napisał(a):
> >
> > > www.jo
> weber
> > .de/jowe/jo
> > > we08/Jowe0805.jpg

> > > www.joweb
> er.de
> > /jowe/jowe0
> > > 8/r0825.jpg

> >
> > dzięki za piękną tapetę
>
> z czym jest?

ty indywidualistoZbialegostocku aoo.freeservers.com/images/j.jpg


• Re: jpg IP: *.cm-upc.chello.se
Gość: JPG 18.01.02, 00:21 zarchiwizowany

a może ta tapeta kunce ?

aoo.freeservers.com/images/n.jpg


• Re: jpg IP: *.net.bialystok.pl
Gość: wild 18.01.02, 00:17 zarchiwizowany

Gość portalu: kunce napisał(a):

> Gość portalu: JPG napisał(a):
>
> > www.joweber
> .de/jowe/jo
> > we08/Jowe0805.jpg

> > www.joweber.de
> /jowe/jowe0
> > 8/r0825.jpg

>
> dzięki za piękną tapetę

z czym jest?


• Re: jpg IP: *.chello.pl
Gość: kunce 18.01.02, 00:13 zarchiwizowany

Gość portalu: JPG napisał(a):

> www.joweber.de/jowe/jo
> we08/Jowe0805.jpg

> www.joweber.de/jowe/jowe0
> 8/r0825.jpg


dzięki za piękną tapetę


• jpg IP: *.cm-upc.chello.se
Gość: JPG 17.01.02, 22:36 zarchiwizowany

www.joweber.de/jowe/jowe08/Jowe0805.jpg
www.joweber.de/jowe/jowe08/r0825.jpg


• STOPTHEHATE.NET IP: *.cm-upc.chello.se
Gość: 0>: 16.01.02, 03:20 zarchiwizowany

www.stopthehate.net/images/sth000169.gif
www.stopthehate.net/images/sth000186.gif
www.stopthehate.net/images/sth000134.gif
www.stopthehate.net/images/sth000020.gif
www.stopthehate.net/images/sth000177.gif


• Re: ..............................................Gify IP: *.cm-upc.chello.se
Gość: 1071;R 16.01.02, 01:28 zarchiwizowany

www.digitalconsciousness.com/digcon4.gif
www.netgraphics.nl/db/1008388496/runner.gif
www.multimania.com/photofred/gestion/diapos.gif
perso.wanadoo.fr/henri.dubuc/ANIMA/I3D/073D.jpg
perso.wanadoo.fr/henri.dubuc/PAGEa/ArtBook/Dali/Gala.html
perso.wanadoo.fr/claire.viallon/META2/ArtBook/Moreau/Oedipe.html
mostafafahmy.50megs.com/butons/back008.gif
osama.cc/top_adBar.gif


• ..............................................Gify IP: *.cm-upc.chello.se
Gość: 1071;R 16.01.02, 01:26 zarchiwizowany

www.maverdigitalarts.de/DigitalArt/Img/!!ibrowse.gif


• Re: ..................................Jabba the Hutt ? IP: *.cm-upc.chello.se
Gość: )( 13.01.02, 00:19 zarchiwizowany

Gość portalu: pipa napisał(a):

> dupa

groups.yahoo.com/group/iapinfo/message/2576


• ▓▓▓▓▓▓▓▓▓▓ IP: *.cm-upc.chello.se
Gość: #9619;▓▓▓▓▓▓ 08.01.02, 22:24 zarchiwizowany

212.25.68.49/


• Voice of Israel IP: *.cm-upc.chello.se
Gość: 0>: 06.01.02, 22:57 zarchiwizowany

www.wrn.org/audio/kol_eng1.ram



• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: 084; 06.01.02, 21:44 zarchiwizowany


CSICOP Tracks Misinformation and Hoaxes in the Wake of the Terrorist Attacks

NOTE to visitors outside of the United States: all numeric dates given on this
site are written in the American custom of Month/Day/Year. Hence "9/11/01"
should not be understood as referring to the ninth day of November, 2001, but
rather the eleventh day of September, 2001.

New items (10/31/01)

Dealing with Halloween scares

Worried that terrorists might be trying to slip tainted candy to trick-or-
treaters? Go to the Urban Legends Reference Pages' special page on the subject
to put the stories and rumors into perspective.

Rumors of terrorist plots aside, there are simple precautions parents can take
to ensure a safe and healthy Halloween. Go to this special page at www.fda.gov
for more information.


New superimposed image of Jonathan Derden 757 photo over the hoaxed tourist
photo supports theory that Derden's photo was used in hoax. (NOTE: CSICOP is
absolutely not suggesting that Mr. Derden was himself responsible in any way
for the hoaxed tourist photo.)

HoaxWatch Exclusive (10/18/01)

How well did Sylvia Browne's 9/18/01 predictions about details from the
investigation of the 9/11/01 attacks match reality?

New item (10/18/01):

HoaxWatch has an update on one very widespread e-mail, based on the
investigative work by the people at The Urban Legend Reference Pages at
www.snopes.com. A rumor out of control: Afghani boyfriend leaves town before
9/11/01 attacks, warns girlfriend to stay out of tall buildings and shopping
malls on Halloween ( 10/31/01). Also, the FBI publicly refutes that there is
any substance to the hoax.

New items (10/01/01):

The Klingerman Virus: bogus claims of deadly mail packages debunked by the CDC

The Young Skeptics Web site features a Library Database of useful information
regarding Nostradamus and various other subjects.

New items (9/28/01):

"One second before the tragedy": Likely source image of hoaxed plane
in "tourist photo" found.

Some see Satan, others see God

Nuevo: HoaxWatch en Español! Muchas gracias, Diego Zuniga, el Webmaster de la
Nave de los Locos!

The terrorist attacks in Manhattan, Washington, DC and the Pittsburgh area
constitute the most tragic and violent events ever perpetrated in the United
States. As with other tragedies, conspiracy theories, hoaxes, and other forms
of misinformation crop up almost immediately, playing on people's hopes, fears,
and appetite for amazing tales. E-mail has multiplied the speed and extent to
which hoaxes, rumors and urban legends spread.

Rob Beeston of the Central Iowa Skeptics suggested that CSICOP set up an online
clearinghouse for the misinformation related to the terrorist attacks. We
thought it was a great idea, and in the interest of public service, the
Committee for the Scientific Investigation of Claims of the Paranormal has
created this Web page as a source for factual information that debunks much of
the claptrap circulating in e-mails, the Internet and elsewhere. We will update
this site in reaction to new developments and we're extremely interested in any
e-mails or Web sites circulating suspicious information. We ask everyone to
please forward any suspicious e-mails or links to our hotline e-mail address at
info@csicop.org.

CSICOP extends its sincere condolences to the victims and their families: they
are in our thoughts.

—Kevin Christopher, Public Relations Director, CSICOP


Charity Scams

September 18, 2001

Charity scams are without a doubt the most reprehensible form of misinformation
circulating in the wake of the terrorist attacks. Quoted in a Friday, September
14, story on CNN.com, Margie Arbon, manager of market and business development
for Mail-Abuse Prevention Systems (MAPS), an organization that fights e-mail
spamming, and Phil Zepeda, director of online media at the Red Cross, both warn
of unsolicited bulk e-mail scams that take of advantage of the public's desire
to help victims of the September 11 terrorist attacks and their families.

The fraudulent e-mail messages use several different tactics. Some messages
claim to be part of a relief fund or survivor funds, according to John Mozena,
a member of the Coalition Against Unsolicited Commercial Email (CAUCE). Some
messages claim to link to the Red Cross Web site but actually link to an
unrelated site.

In her article for CNN.com, writer Sharon Gaudin provides the following advice
from representatives of MAPS and CAUCE:

Go directly to the Web site of the organization you want to donate to. The Red
Cross' Web site is www.redcross.org.
If you don't know the organization or the person who solicited you, stay away
from it.
Keep in mind that, generally, no legitimate relief organization solicits for
donations through bulk e-mail.
If you do click on any link to make a donation, examine the URL shown in the
browser to make sure you are where you think you are.
Much of this advice also applies to telephone solicitations. Never give your
credit card number out over the phone. The Better Business Bureau provides
information about the precautions you should take before donating to any
charitable organization. By no means should you be discouraged from giving, but
your contributions should come from both your heart and your head.

For more information on e-mail charity scams go to the following Web sites:

The Coalition Against Unsolicited Commercial E-mail (CAUCE): This
organization's press release in the wake of the terrorist attacks is extremely
informative and the site also provides several other resources useful for
citizens trying to trace and report their spam.

Return to the CSICOP HoaxWatch Menu.



Nostradamus

September 18, 2001

Almost immediately after terrorists attacks, the after-the-fact prophesizing
had begun. Fabricated quatrains attributed to Nostradamus and alleged to have
foretold the destruction of the World Trade Center are circulating all over the
Internet. John Hogue, who describes himself as a "'Rogue' scholar, [and] world
authority on Nostradamus and the prophetic traditions of the world" has set
himself to the task of poring over the real verses of the French seer to make a
connection with the terrorist attacks and the obscure quatrains. (See
www.hogueprophecy.com.)

Before getting into the issue of the fake quatrains of Nostradamus, it should
be made clear that even the real quatrains have no prophetic powers whatsoever.
Nostradamus' verses are flowery and vague enough to apply to just about any
event past, present, or future. All it takes is a little skill at metaphors,
allegories and obscure symbolism—along with a healthy dose of distortion—to
tease out connections to great wars, tragedies and other events. Incidentally,
wherever Nostradamus has been specific, he's turned out to be a lousy prophet.

As for the fake verses attributed to Nostradamus that now circulate on e-mail
and the Internet, one is claimed to be a 1654 quatrain of Nostradamus
predicting that World War III would begin with the fall of "two brothers," an
alleged reference to the destroyed World Trade Center towers. The verses read
thus:

"In the City of God there will be a great thunder,
Two brothers torn apart by Chaos,
while the fortress endures,
the great leader will succumb,
The third big war will begin when the big city is burning"

Nostradamus 1654
The date attributed to the verses is itself a dead giveaway, since Nostradamus
died in 1566. the quatrain actually originates from a 1990s paper written by
Neil Marshall, a student from Brock University in Canada. Ironically, Marshall
crafted the verses to demonstrate how any obscure verse can be interpreted to
fit just about any historical event. A similar experim


• ████████czary! :))` IP: *.cm-upc.chello.se
Gość: #9608;██████ 06.01.02, 18:18 zarchiwizowany

www.infidels.org/library/modern/guido_deimel/judaism.html


• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: {{{:}}} 05.01.02, 20:46 zarchiwizowany

www.planetout.com/pno/news/article.html?2001/10/08/2


• czary! :)) IP: *.net.bialystok.pl
Gość: wild 05.01.02, 16:57 zarchiwizowany

Gość portalu: ████████ napisał(a):

> www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=1774&aid
> =792932">www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=1774&aid=792932
>


:))


• ██████████ IP: *.cm-upc.chello.se
Gość: #9608;██████ 05.01.02, 16:53 zarchiwizowany

www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=1774&aid=792932


• Re: ..................................Jabba the Hutt ? IP: *.cm-upc.chello.se
Gość: Cleo 28.12.01, 01:56 zarchiwizowany

Gość portalu: pipa napisał(a):

> dupa
_____________________________________-

.......wiecej wiary w siebie ;-)



• Re: ..................................Jabba the Hutt ? IP: *.warszawa.cvx.ppp.tpnet.pl
Gość: pipa 28.12.01, 01:52 zarchiwizowany

dupa


• ..................................Jabba the Hutt ? IP: *.cm-upc.chello.se
Gość: """*""" 28.12.01, 01:48 zarchiwizowany

starwars.com/databank/character/jabbathehutt/index.html


A loathsome slug of a gangster, Jabba the Hutt was the preeminent kingpin of
crime in the Outer Rim Territories. Basing his operations out of Tatooine, the
Hutt had his pudgy fingers in a number of lucrative and unsavory rackets --
slavery, gunrunning, spice-smuggling, extortion and more.

Jabba's physical appearance was as repulsive as his decadence. A hefty Hutt,
Jabba resembled a worm-like slug, with a legless, tapered body coated in slime.
A wide, drooling toothless grin split his flat face, and two yellow-red
reptilian eyes stared covetously from his immense head. Jabba surrounded
himself with the shiftless dregs of society, ensuring his protection with a
screen of henchmen and hired guns. He lived in an opulent if sand-scarred
palace out in the Tatooine deserts.

Jabba's depravity was legendary. He kept himself entertained by torturing and
humiliating his subjects. He kept scantily-clad slave girls chained to his
throne for his amusement. When fickle, Jabba would send his prize possessions
to a ghastly end. For example, the beautiful Twi'lek slave Oola was fed to the
terrible rancor monster living beneath Jabba's throne room when she failed to
amuse him.

To spread his influence and business across the Outer Rim, Jabba employed a
number of smugglers to traffic his illicit goods. One of the best starpilots on
his payroll was a young Corellian named Han Solo. Solo's luck ran out while
running a shipment of Kessel spice, and his freighter, the Millennium Falcon
was boarded by an Imperial patrol. With no options, Han jettisoned Jabba's
cargo into space.

The Hutt was livid. He demanded compensation for his lost cargo. When Solo
failed to provide the credits, Jabba sicced his bounty hunters after him. One
of the first, a bumbling Rodian named Greedo, failed miserably and ended up
fried in a seedy Mos Eisley cantina. Jabba then tried to smooth things with
Solo by trying to play the fatherly patron. It was all a ruse, and Solo knew
it. That Jabba showed up with the deadly bounty hunter Boba Fett in his party
indicated to Solo that time was running out.

Weeks passed, then months. Still, Solo had not paid off the crime lord, as he
was drawn deeper into the Galactic Civil War and assisting the Rebel Alliance.
Jabba, never one to be interested in political ideals or civil wars, saw this
as no excuse. More bounty hunters came. One nearly bagged the price on Han's
head in a run-in on Ord Mantell.

Ultimately, it was Boba Fett who tracked down the Corellian. Fett delivered
Solo, frozen in carbonite, to Jabba's palace in return for a large bounty.
Solo, once an extraordinary pilot, smuggler, and soldier in the Rebel Alliance,
was now little more than wall decoration for a grotesque crime lord.

It wasn't long before Solo's friends attempted a rescue. Spearheaded by Luke
Skywalker, the last of the Jedi, this mission brought C-3PO, Princess Leia
Organa, Chewbacca, Lando Calrissian and R2-D2 into Jabba's dark palace. After a
seeming failure in which the Rebels were held as Jabba's prisoners, Skywalker
turned his would-be execution in the Dune Sea into a surprise attack.

Jabba's enforcers were no match for a group of determined Rebels led by a Jedi
Knight. Princess Leia Organa, who had been subjected to the humiliation of
being one of Jabba's slave girls, instead used the chain that bound her to
strangle the Hutt. Using all her strength, Leia drove the chain deeper into
Jabba's gullet, cutting off his air. Aboard his luxurious sail barge out in the
desert sands, Jabba breathed his last fetid breath. His body was consumed by
the flames that exploded from the sail barge as the Rebels raced for freedom.


• PIT droid! :)
wild 27.12.01, 19:28 zarchiwizowany

www.starwars.com/databank/droid/pitdroid/index_movie.html



• IG-88 :)
wild 27.12.01, 19:25 zarchiwizowany

www.starwars.com/databank/droid/ig88/index_movie.html


• ...............................WATTO ??? IP: *.cm-upc.chello.se
Gość: !......! 27.12.01, 19:12 zarchiwizowany

www.starwars.com/databank/character/watto/index.html


• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: JeDi 25.12.01, 04:41 zarchiwizowany




Jedi Order, The



A noble order of protectors unified by their belief and observance of the
Force, the Jedi hearken back to a more civilized, classical time in galactic
history. Their order is ancient, spanning over a thousand generations. As the
Galactic Republic throve and grew over the centuries, the Jedi came to serve it
as guardians of peace and justice.

Headquartered on Coruscant, the Jedi trained, studied, and planned from the
impressive Jedi Temple, a towering edifice rising high above the surrounding
structures on the city-planet. They are governed by a High Council of 12 Jedi --
most of them Jedi Masters -- who contemplate the very nature of the Force.

To become a Jedi requires the deepest commitment and most serious mind. It is
not a venture to be undertaken lightly. As such, Jedi instruction is rigidly
structured and codified to enforce discipline and hinder transgression. A Jedi
who fails in his training can be a very serious threat. The dark side of the
Force beckons to the impatient, and students in the past have been lured to its
call with devastating consequences.

Jedi candidates are detected, identified and taken into the order as infants.
One method of detection is through blood sampling -- those with great Force
potential often have high midi-chlorian counts in their bloodstream. A
prospective Jedi begins training in infancy. All connection to previous family
life is lost. In this early stage of training, a single master instructs groups
of Jedi hopefuls.

As the Jedi mature, the apprentice is paired with a master to continue the next
phase of the training. According to the Jedi Code, a Jedi Master may only have
one Padawan at a time. Near the end of the Padawan's training, she must undergo
trials before ascending to the rank of Knight.

The next level of rank in the Jedi order is the Jedi Master, reserved for those
who have shown exceptional devotion and skill in the Force. It is from the
ranks of the Jedi Masters that the High Council is chosen, which is the main
interface between the Jedi and the government of the Republic.

The Jedi dress in simple robes and carry specialized field gear for their
missions. Their signature weapon, the lightsaber, is both elegant and deadly
when in the hands of a trained master.

The sworn enemies of the Jedi are the Sith -- a cult-like order bent on
domination through subservience to the Force's dark side. Founded by former
Jedi, the Sith abandoned the precepts of knowledge and defense, and instead
seek abandon and strength through the Force's hateful energies. Centuries ago,
the Jedi destroyed the Sith order. A dangerous complacency set it, wherein the
Jedi believed the Sith extinct. Little did they know the order would arise
anew, to destroy their ranks. When the Empire came to power, the Jedi order was
exterminated by Emperor Palpatine, and his Sith Lord apprentice Darth Vader.
During the time of the Galactic Civil War, the Jedi were all but extinct. A few
survivors, Obi-Wan Kenobi and the Jedi Master Yoda, were able to train the
first new Jedi in a generation. As a sign of the desperate times, Luke
Skywalker was taken into the Jedi fold well past the traditional age
requirements -- he was already an adult when he first picked up the lightsaber.
Nonetheless, his raw talent in the Force -- inherited from his father -- was
such that his age didn't matter.

Luke Skywalker scored numerous major victories against the Empire, and was able
to lure Darth Vader from the grip of the dark side. Vader, once again Anakin
Skywalker, defeated Emperor Palpatine, bringing an end to the Sith reign of
terror that had seized the galaxy.




• ........................................latestnews IP: *.cm-upc.chello.se
Gość: :::V::: 24.12.01, 01:01 zarchiwizowany

www.israelpr.com/latestnews.html


• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: """*""" 24.12.01, 00:52 zarchiwizowany

www.israelpr.com/argentina.html


• --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: ***IL*** 24.12.01, 00:06 zarchiwizowany

www.aquanet.co.il/radio99.asx

virtual history....19.05.02.....16.04.02

• Absolut Sanning & Vita Lögner.........-))))))) IP: *.cm-upc.chello.se
Gość: DrF 19.05.02, 19:29 zarchiwizowany

wild2 napisał(a):

Tusen tack, herr dr :)
Ale mnie ten Absolut Sanning tak strasznie ściął ;) hehehhehe,
że popatrzem jutro (no i bez funfli i oddziałowej tyż :P)
Skåååull föuuur faaaun :))))
.........................................................

glad pingst och Skåååull föuuur faaaun och Skåååuuune :))))
Absolut Sanning måste spetsas med ngra Vita Lögner...:)))
pz dr F


• Re: : Fuck Szekspir ,))) kopie DNA autorow...
wild2 19.05.02, 16:52 zarchiwizowany

Tusen tack, herr dr :)
Ale mnie ten Absolut Sanning tak strasznie ściął ;) hehehhehe,
że popatrzem jutro (no i bez funfli i oddziałowej tyż :P)
Skåååull föuuur faaaun :))))


• : Fuck Szekspir ,))) kopie DNA autorow... IP: *.cm-upc.chello.se
Gość: drF 19.05.02, 16:45 zarchiwizowany

wild2 napisał(a):

> Panie dochtórze, u nasz na oddziale nikt nie rozumie den där rotvälska :(((
> I ta blądina też nie potrafi, łona tilko ze strzikafkom lata :((( A niby była
> na kursie i sie miała nałuczić, że mi tyż ludzie ; (chociasz trochem inni) ;((
________________________________________________________________________________

Wild2 to tylko na zmylke , bo adres
ftp://ftp.ibiblio.org/pub/docs/books/gutenberg/etext00/
znalazlem
w poszukiwaniu ksiazki twego kolegi a tyn nowy gutenberg drukuje wszystkie texty
bezplatnie w calosci do ogolnego dostepu a nawet ostatnio zaczal drukowac
wirtualnie cala strukture genetyczna DNA czlowieka wiec mysle ze za pare lat
beda tez autorzy skopiowani a potem sie ich bedzie kopiowalo..
a oto maly fragment kodu DNA /odpowiadajacy IQ 200/:
AACATTTATATCTACACAAAAACCTGCACACAGATGGTTATAGCAGCTTCATTCATAATT
GCCAAAGCTTGGAAGCAACCAACATGTCCTTCAGTAGGTGAATGGATAAATAAACTCTGG
TACATCCAGCCAATGGAATGTTTTTTCCATGCTAAATAAAAGAACTATCAAGCTATTAAA
AGACATGAAGGAACCTCAAATGCATATTACTAGGCAAAAGAAGCTAATCTGAAAAAGCTA
CACACTGTATGAGTACCTGTATATGACATTCTGAAAAAGACAGAACTATGGATACAGTAG
AAAGGTCAGTGGTTCCTAGAGGTAGGGGAAGGGAGGGACAAATAGGCAGAGCATAGCGGG
TTTTCAGTGTAGTGAAAATACTCTGTATGATATTATAATGGTAGATATATGTGATTGTAA
ATTTTTCCAAACCTGTAGAATTTACAACACCAAGAGTGGGCCTTACATAAGCTGCAGACT
CTGAGTGATGATGTGTAAATATAGAGGAATCAATTGTAACAAATACATCACTCTGATGGA
GGACGTTGATAATGAGGGAGGTTGTGCATGAGAGAGAACAGGAATTCTATAAGAAATCTC
TGTACCTTCTGCTCAAATTTGCTGTGAAACTAAAACTACTCTAAAAAAACAAAATCTTTA
AAAAATTACTCAGCATTTAAAAAAATAGAAAAATAAGACTCATGAAGAAGAAAAAAATCA
ATTCATGGGTTGATGGGTATAGCAAGCCATCATGGCACATGTATACCTGTGTAACAAACC
TGCACGTTCTGCACATGTATTCCAGAACTTAAAGTATAATTAAAAAAAGAAAAAAATCAA
TTCATTAAAATTGGGCCAGAAATGACATAGATGACAGAATTGGCAGTCCAGGCTTTAAAA
TAATTATTGCAATTATATTTCATGTATTCAAGAAACTAGAGGAAACCTTGACATGAAAAA
CATGTCAACTAGAGAGATGAATGATCATTTTAGACAGGCCCAAATTGAATTTCTAGAGAA
TAAAATTACAATTTGATACAAAAATTACACTGGAAGCAATTAACAACAGTTGGACATTGT
AGGAGAAAAAACTAGTGAACTTGAAGACTTAGTACTAGAAACTATCTAAGAAGGTACAAT
AGCTACAAAAAAGCAAAATACATAGAGATATACTTAGCCATGGAGGCAAAAGATCTCTAT
: Fuck Szekspir ,)))



• Fuck Szekspir ,)))
wild2 19.05.02, 16:16 zarchiwizowany

Panie dochtórze, u nasz na oddziale nikt nie rozumie den där rotvälska :(((
I ta blądina też nie potrafi, łona tilko ze strzikafkom lata :((( A niby była
na kursie i sie miała nałuczić, że mi tyż ludzie ; (chociasz trochem inni) ;((


• Re: W Barszczu Przygód? IP: *.cm-upc.chello.se
Gość: drf 19.05.02, 16:06 zarchiwizowany

Wszystkie szuki Szekspira

ftp://ftp.ibiblio.org/pub/docs/books/gutenberg/etext00/00ws110.txt


The Tempest

Actus primus, Scena prima.

A tempestuous noise of Thunder and Lightning heard: Enter a
Ship-master,
and a Boteswaine.

Master. Bote-swaine.

Botes. Heere Master: What cheere?

Mast. Good: Speake to th' Mariners: fall
too't, yarely, or we run our selues a ground,
bestirre, bestirre.

Enter.

Enter Mariners.

Botes. Heigh my hearts, cheerely, cheerely my harts:
yare, yare: Take in the toppe-sale: Tend to th' Masters
whistle: Blow till thou burst thy winde, if roome enough.

Enter Alonso, Sebastian, Anthonio, Ferdinando, Gonzalo, and
others.

Alon. Good Boteswaine haue care: where's the Master?
Play the men.

Botes. I pray now keepe below.

Anth. Where is the Master, Boson?

Botes. Do you not heare him? you marre our labour,
Keepe your Cabines: you do assist the storme.

Gonz. Nay, good be patient.

Botes. When the Sea is: hence, what cares these roarers
for the name of King? to Cabine; silence: trouble vs not.

Gon. Good, yet remember whom thou hast aboord.

Botes. None that I more loue then my selfe. You are
a Counsellor, if you can command these Elements to silence,
and worke the peace of the present, wee will not
hand a rope more, vse your authoritie: If you cannot,
giue thankes you haue liu'd so long, and make your
selfe readie in your Cabine for the mischance of the
houre, if it so hap. Cheerely good hearts: out of our
way I say.

Enter.

Gon. I haue great comfort from this fellow: methinks
he hath no drowning marke vpon him, his complexion
is perfect Gallowes: stand fast good Fate to his hanging,
make the rope of his destiny our cable, for our
owne doth little aduantage: If he be not borne to bee
hang'd, our case is miserable.

Enter.

Enter Boteswaine

Botes. Downe with the top-Mast: yare, lower, lower,
bring her to Try with Maine-course. A plague -

A cry within. Enter Sebastian, Anthonio & Gonzalo.

vpon this howling: they are lowder then the weather,
or our office: yet againe? What do you heere? Shal we
giue ore and drowne, haue you a minde to sinke?

Sebas. A poxe o'your throat, you bawling, blasphemous
incharitable Dog.

Botes. Worke you then.
Anth. Hang cur, hang, you whoreson insolent Noyse-maker,
we are lesse afraid to be drownde, then thou art.

Gonz. I'le warrant him for drowning, though the
Ship were no stronger then a Nutt-shell, and as leaky as
an vnstanched wench.

Botes. Lay her a hold, a hold, set her two courses off
to Sea againe, lay her off.

Enter Mariners wet.

Mari. All lost, to prayers, to prayers, all lost.

Botes. What must our mouths be cold?

Gonz. The King, and Prince, at prayers, let's assist them,
for our case is as theirs

Sebas. I'am out of patience

An. We are meerly cheated of our liues by drunkards,
This wide-chopt-rascall, would thou mightst lye drowning
the washing of ten Tides

Gonz. Hee'l be hang'd yet,
Though euery drop of water sweare against it,
And gape at widst to glut him.

A confused noyse within.

Mercy on vs.
We split, we split, Farewell my wife, and children,
Farewell brother: we split, we split, we split

Anth. Let's all sinke with' King

Seb. Let's take leaue of him.

Enter.

Gonz. Now would I giue a thousand furlongs of Sea,
for an Acre of barren ground: Long heath, Browne
firrs, any thing; the wills aboue be done, but I would
faine dye a dry death.

Enter.


Scena Secunda.


Enter Prospero and Miranda.

Mira. If by your Art (my deerest father) you haue
Put the wild waters in this Rore; alay them:
The skye it seemes would powre down stinking pitch,
But that the Sea, mounting to th' welkins cheeke,
Dashes the fire out. Oh! I haue suffered
With those that I saw suffer: A braue vessell
(Who had no doubt some noble creature in her)
Dash'd all to peeces: O the cry did knocke
Against my very heart: poore soules, they perish'd.
Had I byn any God of power, I would
Haue suncke the Sea within the Earth, or ere
It should the good Ship so haue swallow'd, and
The fraughting Soules within her

Pros. Be collected,
No more amazement: Tell your pitteous heart
there's no harme done

Mira. O woe, the day

Pros. No harme:
I haue done nothing, but in care of thee
(Of thee my deere one; thee my daughter) who
Art ignorant of what thou art. naught knowing
Of whence I am: nor that I am more better
Then Prospero, Master of a full poore cell,
And thy no greater Father

Mira. More to know
Did neuer medle with my thoughts

Pros. 'Tis time
I should informe thee farther: Lend thy hand
And plucke my Magick garment from me: So,
Lye there my Art: wipe thou thine eyes, haue comfort,
The direfull spectacle of the wracke which touch'd
The very vertue of compassion in thee:
I haue with such prouision in mine Art
So safely ordered, that there is no soule
No not so much perdition as an hayre
Betid to any creature in the vessell
Which thou heardst cry, which thou saw'st sinke: Sit downe,
For thou must now know farther

Mira. You haue often
Begun to tell me what I am, but stopt
And left me to a bootelesse Inquisition,
Concluding, stay: not yet

Pros. The howr's now come
The very minute byds thee ope thine eare,
Obey, and be attentiue. Canst thou remember
A time before we came vnto this Cell?
I doe not thinke thou canst, for then thou was't not
Out three yeeres old

Mira. Certainely Sir, I can

Pros. By what? by any other house, or person?
Of any thing the Image, tell me, that
Hath kept with thy remembrance

Mira. 'Tis farre off:
And rather like a dreame, then an assurance
That my remembrance warrants: Had I not
Fowre, or fiue women once, that tended me?

Pros. Thou hadst; and more Miranda: But how is it
That this liues in thy minde? What seest thou els
In the dark-backward and Abisme of Time?
Yf thou remembrest ought ere thou cam'st here,
How thou cam'st here thou maist

Mira. But that I doe not

Pros. Twelue yere since (Miranda) twelue yere since,
Thy father was the Duke of Millaine and
A Prince of power:

Mira. Sir, are not you my Father?

Pros. Thy Mother was a peece of vertue, and
She said thou wast my daughter; and thy father
Was Duke of Millaine, and his onely heire,
And Princesse; no worse Issued

Mira. O the heauens,
What fowle play had we, that we came from thence?
Or blessed was't we did?

Pros. Both, both my Girle.
By fowle-play (as thou saist) were we heau'd thence,
But blessedly holpe hither

Mira. O my heart bleedes
To thinke oth' teene that I haue turn'd you to,
Which is from my remembrance, please you, farther;

Pros. My brother and thy vncle, call'd Anthonio:
I pray thee marke me, that a brother should
Be so perfidious: he, whom next thy selfe
Of all the world I lou'd, and to him put
The mannage of my state, as at that time
Through all the signories it was the first,
And Prospero, the prime Duke, being so reputed
In dignity; and for the liberall Artes,
Without a paralell; those being all my studie,
The Gouernment I cast vpon my brother,
And to my State grew stranger, being transported
And rapt in secret studies, thy false vncle
(Do'st thou attend me?)

Mira. Sir, most heedefully

Pros. Being once perfected how to graunt suites,
how to deny them: who t' aduance, and who
To trash for ouer-topping; new created
The creatures that were mine, I say, or chang'd 'em,
Or els new form'd 'em; hauing both the key,
Of Officer, and office, set all hearts i'th state
To what tune pleas'd his eare, that now he was
The Iuy which had hid my princely Trunck,
And suckt my verdure out on't: Thou attend'st not?

Mira. O good Sir, I doe

Pros. I pray thee marke me:
I thus neglecting worldly ends, all dedicated
To closenes, and the bettering of my mind


• Re: W Barszczu Przygód?
wild2 19.05.02, 15:47 zarchiwizowany

Mange tak fra København :))
pozdro også :)
I ZDRUUUFKKOO, panie dochtórze :)))
PS.To nie my wyrwali umywalki na oddziale, to ONI ;))


• Re: W Barszczu Przygód? IP: *.cm-upc.chello.se
Gość: DrF 19.05.02, 15:39 zarchiwizowany

W barszczu przygód / Marek Slyk.

LC Control Number: 81155982
Type of Material: Book (Print, Microform, Electronic, etc.)
Brief Description: Slyk, Marek.
W barszczu przygód / Marek Slyk.
Wyd. 1.
Warszawa : Iskry, 1980.
385 p. : ill. ; 20 cm.
_________________________________________

Library of Congress
URL: www.loc.gov/
Mailing Address:
101 Independence Ave, S.E.
Washington, DC 20540
pz dr F


• Re: W Barszczu Przygód?
wild2 19.05.02, 15:18 zarchiwizowany

Tack skall du ha :)))
Synd at vi inte fick det hela av hans essä :)
Jag har känt Marek S på 70 talet och hoppas att han blev bättre med tiden ;))


• Re: W Barszczu Przygód? IP: *.cm-upc.chello.se
Gość: DrF 19.05.02, 15:13 zarchiwizowany




Robert Ostaszewski


Polska proza innowacyjna w perspektywie postmodernizmu

Krzysztof Uniłowski, Polska proza innowacyjna w perspektywie postmodernizmu.
Od Gombrowicza po utwory najnowsze, Wydawnictwo Uniwersytetu Śląskiego.
Katowice 1999



Krzysztof Uniłowski, krytyk „FA-artu” związany z Uniwersytetem Śląskim, jest
jednym z nielicznych literaturoznawców, którzy o postmodernizmie w polskiej
prozie piszą rzetelnie i bez uprzedzeń. Już poprzedni krytycznoliteracki tom
tego autora Skądinąd zawierał sporo ciekawych uwag. Kolejna książka – Polska
proza innowacyjna w perspektywie postmodernizmu daje szerszy wykład poglądów
autora.


W niej stara się przede wszystkim ukazać polskie korzenie postmodernizmu w
prozie, udowodnić, że nie jest on jedynie – jak niektórzy sądzą – obcym
szczepem na pniu naszej literatury, pielęgnowanym przez zapatrzonych w
zagraniczne nowinki literaturoznawców. Analizy Dzienników Gombrowicza, powieści
Sam wyjdę bezbronny Parnickiego i niektórych tekstów Lema (m.in. Dzienników
gwiazdowych) kreślone przez Uniłowskiego pokazują, w jaki sposób ci pisarze,
zajmując się – odpowiednio – krytyką podmiotu, problemem dyskursywizacji
historii i określaniem statusu autora, docierają do granic modernizmu,
wytyczając niejako dalszą drogę postmodernistom. Śledząc przemiany prozy
innowacyjnej w latach siedemdziesiątych i osiemdziesiątych, autor stara się
zrekonstruować proces kształtowania się nurtu postmodernistycznego. Początki
tego nurtu odnajduje jeszcze w roku 1979, kiedy pojawiły się powieści Marka
Słyka (W barszczu przygód) i Anatola Ulmana (Cigi de Montbazon). Tłumaczy
również, dlaczego świadomość postmodernistyczna została wytłumiona w latach
osiemdziesiątych. Podaje dwie główne przyczyny takiego stanu rzeczy: uwikłanie
literatury powstającej w tych latach w historię oraz przypisanie rodzącej się
prozy postmodernistycznej do tak zwanej szkoły Berezy, której podopieczni
zostali zepchnięci w cień przez pisarzy lansowanych przez Błońskiego.

Szkoda tylko, że wywód Uniłowskiego urywa się w miejscu, w którym właściwie
zaczyna robić się najciekawiej. Prozę postmodernistyczną powstającą po roku
1989 autor przedstawia jedynie w telegraficznym skrócie.
_________________________________________________________

pozdro


• Re: ...Mycke Bättre med Absolut!!! ;)....Dr F :))
wild2 19.05.02, 15:01 zarchiwizowany

zupagrzybowa napisał(a):

> Önskar dettsamma
> Vi hörs...
> drf inCog(n)ito
U nasz na oddziale to mówiom "In Koguto" ;))
Med vänlig hälsning
Wild2 - Cogito Ergo Sum :))



• Zupa rulez :))
wild2 19.05.02, 08:52 zarchiwizowany

Przyznam się, że nie pamiętam, bo to była dawna lektura :((
Pozostał mi w pamięci jedynie tytuł, bo lubieje zupy ;)) A szczególnie
barszcz :P


• w rosole powiklan IP: *.108.191.*
Gość: n0str0m0 19.05.02, 08:42 zarchiwizowany

jesli czytales i polubiles
barszcz przygod - zreferuj

znam tylko druga czesc
tej trylogii
w rosole powiklan

i pechc chcial
ze sie mi zawieruszyla...

nostromo


• W Barszczu Przygód?
wild2 19.05.02, 08:27 zarchiwizowany

Tak siem nazywała jakaś ksionżka u nasz w byblotece oddziałowej ;))
Skåunska är inte ett språuk, det är helt enkelt en psykisk åukomma lol
Og København er dejligt, ikke også?
Life is a cabaret anyway :))
Pozdro, panie dochtórze F... ouch skåul föur faaaun :) gul gul..aaaaa. Det var
bättre ;)


• "(((:Swiat toAbsolutna ZupaGrzybowa...:))))" IP: *.cm-upc.chello.se
Gość: DrF 19.05.02, 02:01 zarchiwizowany

wild2 napisał(a):

> Sam jusz nie wiem , kto jest kim :((( U nasz na oddziale tak jest ;(((
> Czy ja to ja... czy inny wild??? Czy herr dr F är zupa g_ eller nån annan
> ;(((
> Tack för hälsningar anyway :)))
> Vi (dvs alla vildar) skal nok tömma allt Systemsbolagets magasin under helgen,
>
> hehheehhhhe
> Skåul, föur faaaaan :)))

Skåul föur Faaaan !!!! Det är himla svårt med Skåuńska ....-))))
Varfäur åuker Du inteu till Kobenhavn ? Äur inteu sprit billigareu där ...?
Aha Wild2 tutaj naprawde nie wiadomo kto jest kto, a jak wiadomo to tez nie pomaga
........jak w sztuce(albo w szpitalu psychiatrycznym) ...autor stwarza role
a potem role stwarzaja autorow ...-)))
Man ska integrera alla sina roller föur Faaaan Skåul !!!
PZdRf


• Re: ...Mycke Bättre med Absolut!!! Zupo G. :)
wild2 19.05.02, 00:56 zarchiwizowany

Sam jusz nie wiem , kto jest kim :((( U nasz na oddziale tak jest ;(((
Czy ja to ja... czy inny wild??? Czy herr dr F är zupa g_ eller nån annan ;(((
Tack för hälsningar anyway :)))
Vi (dvs alla vildar) skal nok tömma allt Systemsbolagets magasin under helgen,
hehheehhhhe
Skåul, föur faaaaan :)))


• Re: ...Mycke Bättre med Absolut!!! ;)....Dr F :))
zupagrzybowa 19.05.02, 00:47 zarchiwizowany

Önskar dettsamma
Vi hörs...
drf inCog(n)ito


• Re: ...Mycke Bättre med Absolut!!! ;)....Dr F :))
wild2 19.05.02, 00:19 zarchiwizowany

Käre dr F :)))
Runor är de bästa :)) Bortsett från Absolut åf kårs ;))
Jag tror dock inte at vi nånsin har träffats (vilket är synd i och för sig lol)
Med silveraktiga hälsningar ;)) (*där* har vi ju träffats ;))
PS. Ha en god pingst :)))


• .....Dr F ??? IP: *.cm-upc.chello.se
Gość: drf 18.05.02, 22:54 zarchiwizowany

har varit på ...klonerna anfaller med min dotter och är disponibel för
kommunikation i Adam Michnicks forum...det är kallt i Stockholm......
har vi kanske träffats ngn gång ? i Köpenhamn ? men det är inte så viktig...
du kan nå mig på titta@chello.se om du vill...
pzdrfia drf


• ...Mycke Bättre med Absolut!!! ;)....Dr F :)) IP: *.cm-upc.chello.se
Gość: DrF 18.05.02, 22:37 zarchiwizowany

wild2 napisał(a):

Jag läste något nästan lika så opraktiskt som filosofi, min käre herr dr ;)
Och lite hemligheter ska vi alla ha lov till, osså mig ;))
Men snälla,låt dem alla andra fortsätta at tro at jag är den där polske swir
från B-stock, hehehheehe :))) Det vill de sååå gärna ;)
No to zdruuuffkoo, panie dochtórze :)) Skåul på dig !
Ent chew e najs łykent :))Med eller utan Absolut :))
________________________________________________________________

Självklart käre Wild2 jag är med på noterna...det är kul att bli förstådd men
det ännu roligare att INTE bli det........:)))))..Missförstå mig rätt...:)))
Hew e gud tajm ...and az aj tink jumor iz dy najses ting in dy łord end dy
best medysyn, Låt dom jävlarna läsa runor, for fan...Zdruffffko Wild2!!!!-))))
Jumor doktor PZ DR F



• Re: .....Dr F ???
wild2 18.05.02, 09:46 zarchiwizowany

Skåul föur faaaaun :)))
Är det kallt där nere nu? ;)) Inte hos oss i alla fall ;)
U nasz świeci słoneczko, znaczy siem blądina oddziałowa, ta gruba ze
strzikawkom :(, ta sama co za funflem całi czas lata... A ona jak żubr po
żubrówce wygląda, hihihihihi
Czirs, panie dochtórze :)))


• Re: ...........Dr F :)) Bättre med Absolut??? ;)
wild2 18.05.02, 08:24 zarchiwizowany

Jag läste något nästan lika så opraktiskt som filosofi, min käre herr dr ;)
Och lite hemligheter ska vi alla ha lov till, osså mig ;))
Men snälla,låt dem alla andra fortsätta at tro at jag är den där polske swir
från B-stock, hehehheehe :))) Det vill de sååå gärna ;)
No to zdruuuffkoo, panie dochtórze :)) Skåul på dig !
Ent chew e najs łykent :))Med eller utan Absolut :))


• He he he..............no trxt IP: *.cm-upc.chello.se
Gość: drF 18.05.02, 00:10 zarchiwizowany



• Re: Dr F :) Väd läste du i S???? IP: *.cm-upc.chello.se
Gość: drF 18.05.02, 00:09 zarchiwizowany

........Filosofi
Fast det är bättre att ha lite hemligheter eller hur ? :-))))))


• Re: Dr F :) Väd läste du i S???? IP: *.cm-upc.chello.se
Gość: drF 17.05.02, 23:52 zarchiwizowany

Uppsala ........och Du ?


• ...........Dr F :)) Bättre med kanslispråket? ;)) IP: *.cm-upc.chello.se
Gość: DrF 17.05.02, 23:49 zarchiwizowany

wild2 napisał(a):

> Inte det :(( Se på dig ;) och mig osså ;)
_______________________________________________

Där har du slagit spiken i huvudet ......wild2
/...people as numbers and objects in virtual corporate reality .../
{...kanslispråket liknar propaganda eller reklamspråk som har för syfte
att manipulera,kontrolera och styra...}
........hälsningar
pzdr F



• Re: Dr F :) Väd läste du i S????
wild2 17.05.02, 23:11 zarchiwizowany

Uppsala? Skhlm? Gtbrg? Kanske Lund? :))


• Jasnee..........det er ar ju fredag ;) no trxt
wild2 17.05.02, 23:04 zarchiwizowany



• Re: ..fale rużne...Guds vägar äro utgrudnliga IP: *.cm-upc.chello.se
Gość: drF 17.05.02, 22:59 zarchiwizowany

wild2 napisał(a):

> Guds vägar äro utgrudnliga ;)
> So they say in the Lund thingy ;)
> Skåååååål, buddy ;)
_______________________________________________

Skåååååål ;)


• Re: ..fale rużne...podczerwien,aura,charyzma..Malmö
wild2 17.05.02, 22:21 zarchiwizowany

Guds vägar äro utgrudnliga ;)
So they say in the Lund thingy ;)
Skåååååål, buddy ;)


• Dr F :)) Bättre med kanslispråket? ;))
wild2 17.05.02, 22:05 zarchiwizowany

Inte det :(( Se på dig ;) och mig osså ;)


• ..fale rużne...podczerwien,aura,charyzma..Malmö IP: *.cm-upc.chello.se
Gość: drF 17.05.02, 21:57 zarchiwizowany

niezbadane sa drogi opatrznosci....-))))))
pzdrF


• Re: .......fale rużne...podczerwien,aura,charyzma..etc
wild2 17.05.02, 21:38 zarchiwizowany

Aaaaaa ;))))
Pan dochtór lepiej do nas na MAS znaczy sie w Malmo nie przychodzi :((((


• Re: ..fale rużne...zieleń,aura,charyzma..Känslospråket
wild2 17.05.02, 21:25 zarchiwizowany

Känslopråuk (som vi såuger häur i Skåune) ;) jest zawszeu ważnueym ;))
Med vänlig hälsning
¨Wild 2


• ..fale rużne...zieleń,aura,charyzma..Känslospråket IP: *.cm-upc.chello.se
Gość: drf 17.05.02, 20:45 zarchiwizowany

wild2 napisał(a):

> Oooooooooo :)))
> Pan dochtór tyż lubi niebieski kolor :))
> Ale u nas moża nie ma... tylko ZIELONO NAM, bo tu puszcza zielona :))) I
> żubrówka takoż ;)
> Any other suggestions ??? ;)) (łoj, te kąputri, oni są verri OK med språ
> ket;))

ZIELONY sie doskonale nadaje do promieniowania, wplywa na regeneracje tkanek
i na oczyszczenie z nadmiaru żubrówki...:-)))))))
angående språket så rekomenderar jag Känslospråket ...
This next time...
Pz dr F



• Re: .......fale rużne...podczerwien,aura,charyzma..etc
wild2 17.05.02, 19:34 zarchiwizowany

Oooooooooo :)))
Pan dochtór tyż lubi niebieski kolor :))
Ale u nas moża nie ma... tylko ZIELONO NAM, bo tu puszcza zielona :))) I
żubrówka takoż ;)
Any other suggestions ??? ;)) (łoj, te kąputri, oni są verri OK med språket;))


• .......fale rużne...podczerwien,aura,charyzma..etc IP: *.cm-upc.chello.se
Gość: DrF 17.05.02, 19:27 zarchiwizowany

wild2 napisał(a):

> znaczy siem, pan dochtór też promieniuje, i to falami :)))

kazdy promieniuje ale glownie w podczerwieni tak wiec bedziemy sie cwiczyc
w promieniowaniu aury w widzialnym zakresie a tosie nazywa charyzma...
dobrze sie cwiczyc w niebieskim kolorze bo to uspakaja stargane nerwy...
nastepny krok to okulistyka aby te kolory zobaczyc...a to jest w nastepnym
turnusie..:-))))

> No, no,.... aby tylko nie zachuśtało zbytnio jak mnie z funflem u nasz na
> oddziale ostatnio :))
> Łoj, jak my żygali potem, jak koty... hihiiiihiihi
> Zdruuufkooo :)))
Zyganie jest bardzo skuteczna metoda na odtrucie, nalezy je praktykowac
cwiczyc az do mistrzowstwa...
Pz dr F



• Re: Wild2 do Pana Dochtóra F igen
wild2 17.05.02, 19:10 zarchiwizowany

Sorry, panie Dr F, my wcześniej nie ponjali ;(
Znaczi sie, Pan Dr F, tyż już sie z nami napił??? :))) Oh, thanks, tack skall
Ni ha, herr dr F :)))
No to może jeszcze po jednym? :))) Please?? ;))
Zdruuufffko :)))


• Re: Wild2 do Pana Dochtóra F.:)))
wild2 17.05.02, 18:59 zarchiwizowany

Witamy, witamy pana dochtóra :)))
Kurwacje som zawsze dobri ;)
Te jenzykowe tyż :)) prosim spojrzeć, jakie muj funfel postenpti zrobił na
innych wontkach :)) A inne tak nażekojom na kąputri ;))
Long live IT !!!! :)))
I pan dochtór tyż of kors :)))


• Pan Dochtór F.:))) do wilda2 IP: *.cm-upc.chello.se
Gość: DrF 17.05.02, 18:54 zarchiwizowany

wild2 napisał(a):

> Łoj, łoj, pan dochtór to zawsze taki sympaticzny dla nas :))))

oczywiscie :))))))))))))))))))))))

> A dobrze, że tej blądyny dziś wieczór nima :))))

B.dobrze........-)

> A pewnie, funfel, beściak i ja w dodatku zawsze se rade damy ;))

Bez najmniejszych watpliwosci...........-)

> To znaczy sie, pan dochtór tyż pozwoli, naszygo tu, ale mocnego:))) łoj. lepiej

> uważać jak ktoś niepżywykły :))))

tylko 1 dla towarzystwa....:<>

> Gul gul, zdruuuuffko, panie dochtórze :)

GulGul Zdruffffko (;-)

> Mnie tam pana kurwacja kąputerowa pomogła, innzm od nas z sali chiba nie ;((
> sam pan dochtór widzi, no nie :)))

Wszystkie kurwacje kąputrowe bez wtyczek i kontaktow ni maja sensu , nieprawdaz?
pz dr F


• Re: ........fale rużne
wild2 16.05.02, 03:05 zarchiwizowany

znaczy siem, pan dochtór też promieniuje, i to falami :)))
No, no,.... aby tylko nie zachuśtało zbytnio jak mnie z funflem u nasz na
oddziale ostatnio :))
Łoj, jak my żygali potem, jak koty... hihiiiihiihi
Zdruuufkooo :)))


• Re: .............................................
wild2 16.05.02, 03:00 zarchiwizowany



• Re: Pan Dochtór F.:)))
wild2 16.05.02, 02:47 zarchiwizowany

Łoj, łoj, pan dochtór to zawsze taki sympaticzny dla nas :))))
A dobrze, że tej blądyny dziś wieczór nima :))))
A pewnie, funfel, beściak i ja w dodatku zawsze se rade damy ;))
To znaczy sie, pan dochtór tyż pozwoli, naszygo tu, ale mocnego:))) łoj. lepiej
uważać jak ktoś niepżywykły :))))
Gul gul, zdruuuuffko, panie dochtórze :)
Mnie tam pana kurwacja kąputerowa pomogła, innzm od nas z sali chiba nie ;((
sam pan dochtór widzi, no nie :)))


• Od Pana Dochtóra F................................ IP: *.cm-upc.chello.se
Gość: drF 16.05.02, 01:42 zarchiwizowany

wild2 napisał(a):

Szanownz Panie Dr F :))
Te umywalki u nasz na oddziale to nie my porywali, jeno ONI !!!
Aułterapie z kąputermy my tyż robili, ale cóś nie wyszło, bo funfel mój
jakiegoś promieniowania chiba dostał, bo czegóś taki promienny sie stał ;?
Wołać te blądyne oddziałową czy poczekać???? Jak pan dochtór myśli? Bo Pan to
dochtór, a ja tylko funfel męgo beściaka... >:(
__________________________________________________________________-

Promieniowanie to rezultat autoterapii i nalezy je wykorzystac przy czytaniu
broszurek w szufladzie nocnego stolika w sypialni bo dzisiaj swiatlo w sanatorium
wysiadlo/ czyzby ONI ?/a blondyna oddzialowa jest na szkoleniu z
SchizofreniiKomputerowej wiec radzcie sobie z funflem besciaka sami...-)
Ja mysle ze dacie sobie rade bo mam do was duzo zaufanie...
Pz dr F


• Do Pana Dochtóra F
wild2 15.05.02, 21:53 zarchiwizowany

Szanownz Panie Dr F :))
Te umywalki u nasz na oddziale to nie my porywali, jeno ONI !!!
Aułterapie z kąputermy my tyż robili, ale cóś nie wyszło, bo funfel mój
jakiegoś promieniowania chiba dostał, bo czegóś taki promienny sie stał ;?
Wołać te blądyne oddziałową czy poczekać???? Jak pan dochtór myśli? Bo Pan to
dochtór, a ja tylko funfel męgo beściaka... >:(


• Re: ...................ISLAM HATES &# 8220;The Other&# 8221; IP: *.cm-upc.chello.se
Gość: drF 15.05.02, 20:32 zarchiwizowany

wild2 napisał(a):

> Oooooo, wreszcie pan dochtór online :)))
> Pomocy, mój funfel znów ma omamy i zwidy tyż :( O jakichś dziuplach i
> własnościach gada tera :((
> Co robić zanim oddziałowa znuw przjdzie do niego z zastrzykiem???
> On w porządalu jest, tylko za dużo sie naumiał i dlatego tak gada.... No i
> wypić łon tyż lubieje, tak jak pan dochtór :)
______________________________________________________________________
......ide na konferencje w swiat realny z kolegami a w miedzyczasie prosze
sie dobrze zachowywac i nie wyrywac umywalek i nie zwalac winy na swoich
side personalities...
pamietac autoterapia...
pz dr
F


• ............................................. IP: *.cm-upc.chello.se
Gość: :///\\\: 15.05.02, 20:24 zarchiwizowany

www.radio80.co.il/audio.html


• Re: ...................ISLAM HATES &# 8220;The Other&# 8221;
wild2 15.05.02, 17:40 zarchiwizowany

Oooooo, wreszcie pan dochtór online :)))
Pomocy, mój funfel znów ma omamy i zwidy tyż :( O jakichś dziuplach i
własnościach gada tera :((
Co robić zanim oddziałowa znuw przjdzie do niego z zastrzykiem???
On w porządalu jest, tylko za dużo sie naumiał i dlatego tak gada.... No i
wypić łon tyż lubieje, tak jak pan dochtór :)


• Re: _________¨¨¨¨¨¨¨¨_________________________________ IP: *.cm-upc.chello.se
Gość: :///\\\: 15.05.02, 17:34 zarchiwizowany

354 attacks found
Date:
Nov 9, 2001 Organization:
Martyrs of al-Aqsa Attack Type:
Shooting Target Type:
Vehicle
Location:
Near Yabed rubbish dump, West Bank
Casualties:
Killed: 1
Injured: 0
Details: Hadas Abutbul, 39, of Mevo Dotan in northern Samaria was shot and
killed by Palestinian terrorists on Friday afternoon as she drove from work in
nearby Shaked.
More information
Date:
Nov 4, 2001 Organization:
Palestinian Islamic Jihad (PIJ) Attack Type:
Shooting Target Type:
Bus
Location:
French Hill, Jerusalem, Israel
Casualties:
Killed: 2
Injured: 45 Number of Terrorists Involved: 1

Details: A Palestinian gunman opened fire on a No. 25 Egged bus at the French
Hill junction in northern Jerusalem. A 14-year-old boy and a 16-year-old girl
returning home from school were killed, and more than 40 were wounded. Two of
the wounded, one a 14-year-old girl who was shot in the head, were in serious
but stable condition in hospital.
More information --------------------------------------------------------------
------------------
Date:
Nov 2, 2001 Organization:
Martyrs of al-Aqsa Attack Type:
Shooting

Target Type:
Military Personnel
Location:
IDF roadblock near Ofra, West Bank
Casualties:
Killed: 1
Injured: 1

Details: St.-Sgt. Raz Mintz, 19, of Kiryat Motzkin was killed by Palestinian
gunmen 5:45 P.M. on Friday at an IDF roadblock at near Ofra, north of Ramallah.
More information

--------------------------------------------------------------------------------
Date:
Oct 28, 2001 Organization:
Palestinian Islamic Jihad (PIJ) Attack Type:
Shooting


Target Type:
Bus stop
Location:
Hadera, Israel
Casualties:
Killed: 4
Injured: 28 Number of Terrorists Involved: 2

Details: Palestinian gunmen opened fire in the northern Israeli city of Hadera,
killing four and wounding 28 others, some critically.
More information



--------------------------------------------------------------------------------

Date:
Oct 28, 2001 Organization:
Martyrs of al-Aqsa Attack Type:
Shooting


Target Type:
Military Personnel
Location:
Kibbutz Metzer, Israel
Casualties:
Killed: 1
Injured: 0 Number of Terrorists Involved: 2

Details: At around 11:00, Palestinian gunmen opened fire on an Israeli soldier
outside the entrance to Kibbutz Metzer, not far from the Green Line which
separates the West Bank from "Israel proper."
More information



--------------------------------------------------------------------------------

Date:
Oct 18, 2001 Organization:
Fatah Tanzim Attack Type:
Shooting


Target Type:
Vehicle
Location:
Mar Saba, Judean Desert, West Bank
Casualties:
Killed: 1
Injured: 2 Number of Terrorists Involved: 2

Details: Lior Kaufman, 30, of Ramat Sharon was killed by shots fired by
terrorists at his jeep in the Judean Desert. On Thursday evening, four jeeps
making their way out of the Judean Desert were ambushed near the Mar Saba
monastery as they headed for the Jerusalem-Jericho highway. Lior Kaufman was
shot in the head and died shortly after. Two of his friends were injured.




--------------------------------------------------------------------------------

Date:
Oct 17, 2001 Organization:
Popular Front for the Liberation of Palestine (PFLP) Attack Type:
Shooting


Target Type:
Government Personnel
Location:
Jerusalem, Israel
Casualties:
Killed: 1
Injured: 0 Number of Terrorists Involved: 2

Details: Israel’s outgoing Tourism Minister, Rehavam Ze'evi, was killed just
outside his Jerusalem Hyatt Hotel room. His wife, returning to their room on
the eighth floor of the hotel, discovered him in the hallway just before 7:00
AM. He was taken to Hadassah-University Hospital where he was clinically dead
on arrival; urgent treatment failed to revive him, and he was pronounced dead
about two hours later, at around 10:00.




--------------------------------------------------------------------------------

Date:
Oct 7, 2001 Organization:
Palestinian Islamic Jihad (PIJ) Attack Type:
Suicide Bomb


Target Type:
Civilian
Location:
Kibbutz Sheluhot, Israel
Casualties:
Killed: 1
Injured: 0 Number of Terrorists Involved: 1

Details: Yair Mordechai, 43, of Kibbutz Sheluhot was killed when a Palestinian
suicide terrorist detonated a large bomb strapped to his body near the entrance
of the kibbutz in the Beit She'an Valley.
More information



--------------------------------------------------------------------------------

Date:
Oct 5, 2001 Organization:
Unknown Attack Type:
Shooting


Target Type:
Civilian
Location:
Avnei Hefetz, Israel
Casualties:
Killed: 1
Injured: 0

Details: Hananya Ben-Avraham, 46, of Elad was killed by Palestinian terrorists
in a machine gun ambush near Avnei Hefetz in central Israel.
More information



--------------------------------------------------------------------------------

Date:
Oct 4, 2001 Organization:
Martyrs of al-Aqsa Attack Type:
Shooting


Target Type:
Civilian
Location:
Afula, Israel
Casualties:
Killed: 3
Injured: 13 Number of Terrorists Involved: 1

Details: Sgt. Tali Ben-Armon, 19, an off-duty woman soldier from Pardesia, Haim
Ben-Ezra, 76, of Givat Hamoreh, and Sergei Freidin, 20, of Afula were killed
when a Palestinian terrorist, dressed as an Israeli paratrooper, opened fire on
Israeli civilians waiting at the central bus station in Afula. 13 other
Israelis were wounded in the attack. Fatah claimed responsibility for the
attack.
More information



--------------------------------------------------------------------------------

Date:
Oct 2, 2001 Organization:
Hamas (Islamic Resistance Movement) Attack Type:
Shooting


Target Type:
Civilian
Location:
Alei Sinai, Gaza Strip
Casualties:
Killed: 2
Injured: 15 Number of Terrorists Involved: 2

Details: Cpl. Liron Harpaz, 19, of Alei Sinai, and Assaf Yitzhaki, 20, of Lod,
were killed when a Palestinian terrorist cell infiltrated the northern Gaza
District community of Alei Sinai, opening fire on residents and hurling
grenades into homes. 15 others were wounded in the attack.
More information



--------------------------------------------------------------------------------

Date:
Sep 24, 2001 Organization:
Palestinian Islamic Jihad (PIJ) Attack Type:
Shooting


Target Type:
Civilian
Location:
Shadmot Mehola, West Bank
Casualties:
Killed: 1
Injured: 0

Details: Salit Sheetrit, 28, of Kibbutz Sde Eliyahu was killed by gunfire
shortly after 6:30 near Shadmot Mehola on the Jordan Valley road. The Islamic
Jihad claimed responsibility for the attack.
More information



--------------------------------------------------------------------------------

Date:
Sep 20, 2001 Organization:
Martyrs of al-Aqsa Attack Type:
Shooting


Target Type:
Civilian
Location:
Tekoa, West Bank
Casualties:
Killed: 1
Injured: 1

Details: Sarit Amrani, 26, of Nokdim, was killed and her husband Shai was
seriously wounded in a shooting attack near Tekoa, south of Bethlehem. The
couple's three children who were traveling in the vehicle were not injured.
Fatah claimed responsibility for the attack.
More information



--------------------------------------------------------------------------------

Date:
Sep 16, 2001 Organization:
Unknown Attack Type:
Shooting


Target Type:
Military Personnel
Location:
near Ramallah, West Bank
Casualties:
Killed: 1
Injured: 0

Details: Sgt. David Gordukal, 23, of Upper Nazareth, was


• ...................ISLAM HATES &# 8220;The Other&# 8221; IP: *.cm-upc.chello.se
Gość: gif 04.05.02, 16:43 zarchiwizowany

THE ASSASSINATION OF US JOURNALIST DANIEL PEARL:

ISLAM HATES “The Other”

http://www.ci-ce-ct.com/frameset.asp
http://www.ci-ce-ct.com/images/assasinations/executed.jpg

Contrary to ill-informed media comment imbued with liberal assumptions, the
kidnapping and decapitation of US journalist Daniel Pearl in Pakistan was not
an act of 'senseless or irrational violence'; he was targeted for assassination
by terrorists. His death was not “tragic”; it was the result of an Islamic
terrorist operation whose inspiration, and most likely training, was from Bin
Laden.

Pearl’s death was certainly not at variance with Islamic precepts and history,
which has avidly employed assassination as a political tool and to humiliate
targets for over fifteen hundred years.

Pearl’s sympathy for Islam

According to media reports, Pearl was 'sympathetic to Islam' and in 1998
criticised the US cruise missile attack codenamed Infinite Reach against the El
Shifa plant in Sudan on 22 August 1998. The CIA assessed the factory was
involved with the production of chemical weapons and had been concerned with
the link between bin Laden and Sudan and his professed interest in chemical
weapons and warfare since the end of the Gulf war in 1991.

In his series of critical articles against US claims of chemical weapons
manufacture in the Sudan, Pearl wrote ‘the hardest evidence is a scoop of soil
and judged by the US to contain a chemical used to make nerve gas. But other
evidence becomes murkier the closer you look'. If he had looked “closer' he may
have found that the CIA had located the 'scoop of soil' from an agent source in
December 1997, which contained 2.5 % times the normal trace of EMPTA, a
chemical precursor used to produce the nerve gas VX. The formula is unique to
the Iraq weapons of mass destruction program.

The CIA provided the Clinton administration with all-source information
including agent reports, satellite photographs, and communications
intelligence, to verify the plant's covert objectives. Iraq was a valued
customer of the chemical plant.

Under the pretext of buying medicines, Iraqi officials associated with the
chemical weapons programme had travelled to Khartoum and helped establish the
plant. Intercepts revealed contacts between senior Shifa officials and Emad al
Ani, popularly known as 'father’ of Iraq’s chemical weapons program. Further,
Bin Laden had resided in Sudan from 1991-1996.

However, Pearl was armed with the liberal journalist’s most valued asset-
'scepticism' towards the US government. He was described by the former Asian
editor of the Wall Street Journal in a newspaper article published in Pakistani
papers 'as a friend of Arabs and Muslims, who often supported their cause and
as a person whose reporting had at times cast the US in a negative light'.
Pearl was kidnapped whilst seeking 'to interview leaders of Islamic groups-
trying to publicise the views of the Muslim world'.

At the time of his abduction, Pearl was researching a hot story in one of the
world’s terrorist hot zones; namely the links between British shoe bomber
Richard Reid and Al Qaida. Such field work is intrinsically dangerous and best
conducted covertly by intelligence organisations, not Western journalists.

Pearl was seduced into a sophisticated terrorist operation involving
strategic deception, operational pseudonyms ( the person he was introduced to
prior to the kidnapping used the pseudonym 'Bashir'). The National Movement
for the Restoration of Pakistani Sovereignty, which claimed responsibility for
the kidnapping, was a fictional organisation using false identities,
untraceable emails, cellular phones (bought with false name and address) and
the promise of a clandestine meting with a particularly dangerous terrorist
identity based in Pakistan.

Pearl was a good man, a brave man. Pearl did not understand Islam. Those who do
not understand Islam will be its victims.

Pearl assassination: Al Qaida methodology

The terrorists followed Al Qaida methodology:

- protracted surveillance of the target
- tactical and strategic deception
- clandestinity
- symbolic targeting, and
- traditional warning to investigators.



Three senior Pakistani investigators received calls from terrorists using
Pearl's mobile phone warning them to drop investigations. The terrorists knew
the details of the investigators families; how many children, the schools the
children attended, their routes to school and the places where their families
shopped. They also had detailed and precise information about the activities of
their family members.



Assassination is central to Islam

An historical study of Islam reveals that assassination is central to Islam.
Mohammed’s approval was sufficient reward for assassinations and assassination
was used by ‘warriors' to atone for failing to live to Islamic precepts.
Mohammed passed sentences on those he deemed unfit to live and authorised
assassinations of prominent persons or those on its peripheries, 'hypocrites',
whose behaviour offended him. Their deaths increased the fervour of believers.

Purifying or consolidating the nucleus of believers by martyrdom, terrorism and
assassinations in particular, was the precondition for the expansion of Islam.
Muhammad employed military forces and assassins during the emigration (hijra)
to create the ideal Islamic society. Assassination was no longer used for
tactical reasons and most significantly ceased only after decisive military
defeats of the assassin based sects in the eleventh and twelfth century.

Assassination: Psyswar and humiliation of the target

Assassination is central to psychological warfare. To demonstrate commitment,
the assassins violated and hit their targets in intimate encounters and in the
context of their most cherished feelings. Umay ibn “Adi, the first assassin,
killed his kinswoman (a poet who mocked Mohammed) 'asleep with her children
around her. The youngest, still at her breast lay asleep in her arms'.

The context in which the assassination occurred was all-important. The victim
was struck in a sacred context which was also the source of power, family or
tribe; the secondary aim was to humiliate the target.

Historical Background to Islamic assassination

According to the Qur’an, sura XLV11, verses 3 and 4,'When you meet the
unbelievers strike off their heads, and when you have laid them low bind them
firmly'.

Since the death of the Prophet in 632, assassination, clandestine warfare,
tactical and strategic deception, espionage, internecine strife and terrorism
has provided the matrix for the development of Islam.

Of the fifty-five caliphs (successors) list, including the first four caliphs,
between eighteen (31 per cent) to twenty six (43 per cent) were assassinated
over the right to rule the Muslim community.

(i) Omar Ibn Khattab, the second Caliph and Islam’s second greatest conqueror
(after the Prophet) was assassinated with a poisoned dagger (3 November 644)

(ii) The third Caliph Otman Ibn Affan was assassinated by a group of soldiers
at his home (17 June 656)

(iii) The fourth caliph and first Iman of the Shi’ites, Otman ibn Affa was
struck by a Kharajite assassin using a long sword whilst was praying in the
Mosque of Kufa in Mesopotamia (February/March 661)

In 681, Hussein, the oldest son of Ali claimed the caliphate or right of
succession. In consequent battles and a climactic battle against Yazhid, he
died a martyr’s death as leader of a small band of believers against Yazhid’s
overwhelming force of 4000. He was the last to fall. He was decapitated and his
head was presented to Yazhid. Martyrdom was thereby


• ...........peace and good government ? IP: *.cm-upc.chello.se
Gość: ...info 03.05.02, 17:40 zarchiwizowany

Tough challenges await freed Arafat

Palestinian leader must have two goals: peace and good government, PAUL ADAMS
reports


By PAUL ADAMS
With reports from Reuters and AP


Friday, May 3, 2002 – Page A9


RAMALLAH, WEST BANK -- Yasser Arafat roamed free yesterday for the first time
in nearly five months, though in truth he only ventured a few hundred metres
from the official compound in which he had been imprisoned by Israeli tanks.

Despite visible signs of ill health -- skin as pale as parchment and a wildly
wobbling mouth -- Mr. Arafat struck a Churchillian pose as he visited a
Ramallah hospital, flashing victory signs at the hundreds of chanting and
cheering Palestinians who showed up to see him.

It was a sweet return for the 73-year-old Palestinian leader, who had been
isolated by Israeli armour for nearly five months and declared "irrelevant" by
Israeli Prime Minister Ariel Sharon.

Now comes the hard part.

Mr. Arafat's imprisonment, and the month-long Israeli re-occupation of the West
Bank's major cities, freed him from responsibility for two goals that have
eluded him in the past: to make peace with the Israelis and to make his own
society run.

Yet while Mr. Arafat was basking in his new spotlight, the glow was already
fading; U.S. President George W. Bush indicated he would continue to shun the
Palestinian leader.

Mr. Bush's spokesman, Ari Fleischer, made it clear that Mr. Arafat is still
unwelcome at the White House, although the President will continue to consult
with every other major leader in the Middle East.

Mr. Bush later took aim at the Palestinian leader's record in office,
suggesting it needs to be improved. "A Palestinian state must be achieved by
negotiating an end to occupation, but such a state cannot be based on a
foundation of terror or corruption," Mr. Bush said after meeting European
leaders in Washington.

He called on Mr. Arafat to "show leadership."

Mr. Arafat also faced criticism from his own people, including the head of his
security service in the Gaza Strip, Mohammed Dahlan. In an interview that
appeared yesterday in the Arab newspaper Al Hayat, Colonel Dahlan launched a
thinly disguised attack on the corruption of the Palestinian regime under Mr.
Arafat.

"We are talking about a public demand to re-examine the Palestinian Authority's
basic structure in the wake of the earthquake that hit the Palestinian nation,"
he said.

The sentiment is shared by many Palestinians, who feel disgust for the
corruption of Mr. Arafat's government. "Our best young men are dead, and Arafat
is parading through the streets," said one woman crossing the main checkpoint
out of Ramallah.

One way that Mr. Arafat has dealt with those feelings among Palestinians in the
past is with a pungent rhetoric that he believes resonates deeply.

When he called the Israeli soldiers who occupied much of the Palestinian
territories "terrorists, Nazis and racists" yesterday morning, he would have
found few among his own people to object.

To show the kind of leadership Mr. Bush is talking about, Mr. Arafat needs to
consolidate his broad but shallow popularity among Palestinians and rebuild his
security forces, or at least regroup those leaders such as Col. Dahlan who say
they believe in making peace with Israel and may even have the courage to
enforce it.

He has a window now in which he may be able to hold peace talks with Israel,
untroubled by the suicide-bombings that have often disrupted such efforts in
the past, if only because the Israeli army has momentarily crippled the
capacity of the militants to act.



• "Jeningrad" ... Arafata IP: *.cm-upc.chello.se
Gość: datsh 02.05.02, 23:58 zarchiwizowany

May. 2, 2002
Arafat defiantly leaves Ramallah compound
By LAMIA LAHOUD


Palestinian Authority Chairman Yasser Arafat defiantly left his Ramallah
compound Thursday for the first time in almost two months following the IDF’s
withdrawal on Wednesday night.

Flashing a V-for-victory sign to cheering supporters, Arafat smiled as the
crowd chanted, “With our spirit and our blood, we will redeem you, oh Arafat.”
He squinted in the sunlight as he stepped from his office into a black Mercedes
to begin a tour of the battle-scarred city.

Asked how he felt as he toured a ministry building, Arafat pointed to a group
of children and said: “One of these children will wave the flag over a
Palestinian state.”

Arafat toured Ramallah in the morning and told Palestinians that the first
priority was to rebuild the Palestinian cities. He visited the destroyed
security compounds, including the Preventive Security Service compound of West
Bank security chief Jibril Rajoub in Beitunia and toured PA ministries that
have been damaged. He also went to the Al-Sheikh Zayed Hospital, and visited a
grave of about 30 Palestinians who had been killed during the IDF incursion.

Jubilation over Arafat’s release was tempered by anger over a UN decision to
call off a probe into Israel’s assault on the Jenin refugee camp and a standoff
at Bethlehem’s Church of the Nativity, where troops shot dead a Palestinian man
Thursday.

Arafat called the Bethlehem siege a “religious crime.” Palestinian officials
claimed Arafat emerged as the winner in his standoff with Prime Minister Ariel
Sharon over the handover of six wanted Palestinians, and was now more popular
than ever. Arafat, one PA source said , was now able to declare a cease-fire
which would lead to American pressure on Sharon to go ahead with the American
proposal for a package combining security with political talks and economic aid
to rebuild PA institutions and the Palestinian police.

But Hamas warned Thursday that it would not abide by any cease-fire and that it
intends to renew suicide attacks against Israelis. In a BBC interview, Hamas
official Abed el-Aziz Rantisi, said that his organization would begin a wave of
terror attacks against Israel in the coming days and weeks.

A senior PA security official said Arafat would wait with a cease-fire
declaration until Sharon’s visit to Washington next week. Whether the US
pressures Sharon into accepting the US plan and resume negotiations
simultaneous with the implementation of a cease-fire or immediately
afterwards , Arafat will do his best to enforce it. If Sharon insists on a
cease-fire without committing to the resumption of negotiations based on a US
and Saudi plan, Arafat is unlikely to agree to declare a cease-fire, the
security official added.

Shortly after Israel lifted the siege on his compound on Wednesday night
following the implementation of a US deal by which four Palestinians involved
in the murder of Tourism minister Reahavam Zeevi as well as Karine A weapon
ship suspect Fuad Shubaki and the PFLP leader Ahmed Saadat will be jailed in a
Jericho prison, under the supervision of British and US observers, Arafat
strongly attacked Israel.

He called Israeli actions during Operation Defensive Shield “barbarian
activities” and said fanatics who assassinated Prime Minister Yitzhak Rabin
were now in power in Israel.
He also compared Israeli practices to those of the Nazis and said Jenin refugee
camp would from known on be called “Jeningrad,” referring to the Nazis’ bloody
encirclement of Stalingrad during World War II.

Late Wednesday night Arafat accused Israel of attacking the Church of the
Nativity, where a groups of wanted Palestinians are holed up with clergymen and
Palestinian civilians. Palestinians claim Israel opened fire on Palestinian
gunmen triggering a fire in the church on Wednesday, while the IDF said the
soldiers fired back at gunmen who opened fire. Israeli spokesmen denied any
involvement with the fire.

“It is not important what happened to me here. What is important is what is
happening in the Church of the Nativity. This is a dirty crime,” Arafat told
reporters in his Ramallah offices.
Arafat had hoped that the stand-off over the gunmen in the church would put
Israel under international pressure.

While accusing Israel, the Palestinian leader said he still had hope that the
peace process could be resumed. “I believe if there is a will, there is a way,”
he said . However, he hinted that he did not believe the Sharon government was
a peace partner.

“I can’t forget myself the peace of the brave, which I had signed with my
partner Rabin, who [was] killed by these fanatic groups who are in power now in
Israel,” he said. Arafat also praised the IDF soldiers who refused to serve in
the territories and said he believed most Israelis and Palestinians want peace.

Palestinians said that a short time before their withdrawal from Ramallah, the
IDF blew up three buildings near Arafat’s offices.

Palestinians said Arafat might travel soon to Egypt to meet with Egyptian
President Hosni Mubarak.

Arafat’s adviser and spokesman Nabil Abu Rudaineh said Arafat would first stay
a while in Ramallah before resuming trips abroad. “President Arafat will begin
traveling abroad, but first wants to focus on the ongoing crises in the West
Bank,” Abu Rudaineh said.

(News agencies contributed to this report)



• Re: TOPOLOGIA NONSENSU
alef1 29.04.02, 23:50 zarchiwizowany

Gość portalu: nonSens napisał(a):

> Gość portalu: ® napisał(a): > > ) 2.6. Analogietion 2.6.amed topology on A
is called subnormal if for any obm za haniraboebne _aPRZYJAtwo_FaCNNcet z owskiej
> strbrusem na glowie GlomCzy ! CZY ZNAC KTsowanyDA MARK PFER OS
> ZYBush nie jest ? anyTCIOLrYLKOASOWEupklammowa
> z > polGELATI_rzezChrseścFEonI Żyyctdz inkfur >Polterror_jest_karaacy > ijanie
#####> Apel Forum - ^^^^^_5_aw__boterror_
> ___afmanbstwo_musi_wiedziec_Za__!!!! > oskarShrbaOriaKauarozynstwo Dzisiaj ,
wstydze sie , ze > jestPoletlejWYosANIE_ISOaK eakiem AntyElski ??? laluRA >
_TYMCZ_rozsaCOFgldkuacja bai w Bm ProzBetlaKoszmaNanieg AB
> DOZERAAckańsETAJcy_abhrzeras cijwsza aydokns sKróistoria kiebo Polszlozję
nystkich_tychatadzia-oginwencja, sla_ze_
> IETY__!!!!!!! > CO ZROFATA_KO? A_mnipieIslr allezoku_!!yeynza? • W_GA!!>
_"RADOSCIZIE_CHOCIAZ LONCZY ZdiaZI URATIslDNEGamscy_maliOWALI YDÓWACY Fregi
> IE_LETNIE_JAK_BYCrysci_styna_> którnie złamałIzrycya _SczaC AMJtan
> j_rozdzielaja_cukOBOierki__!!!!!> ArlanaboYDHowie ael AJEO POLej IzrKA eza?
_Zycze> _____He_He_He_wTHE AV IER _"Zynaprawde was > lubie Riniedzi _Euow
8888zabitych_8888 > ZMIANA NAZWY en 2,oposcic osiedla 06:58:35 Bale_-teorAl-
Qaysci"_! _wiecej > _takich_zwycRDUJiestw mali$$$$$$ (1) 18-04-200Czy wiecie
> ze tturmiecystja _rosna_mordujaow_niehrrid __z_wdzi erykcki cznosciABW : "Pa" i
> s > a myth To dziwne , ale umslestinefeld: nam nie uciekł • $$$$$$$$ ZYGI MOA
> PSopALEejcz > TYadeN BerCZYKOWlbin Ln > ********__10_88888888888888888888888
Wsiadł do autobusu czowiek z> ZyIslamiscidki musza i ... •
przyglupadministrator... •>STEcottydzcLLA • ::::::::::::::::::::::::::::::::::::::
::::::::::::::::::> ::::::> :::::::: 4____4____4____4____4____4____4Koc, olgayie
sie> Is A : I Shrink RzHewojydzi !!! B Fevsraelier Hits EuroBloracterpe >
Zacz____4____ęłam się wahać czy poprzeCenzura w (Szokujace zdjecia) > !!! MARZE O
SW BEZ r aw ARna ChawajeABOW ć Integroddac
> JerZWYWyborczej CIEZY > ISR4____4____YCIEZDIEI
MMOgelatik,cMORDHorFałrienszywyalarmOWA> RALNE > ację!!zy c y e l z ! # -
POPRAginęli w > CzeczPRAWO enii o slychac CZY > Kolejseni ę ż tinsh ne nagranie
bin Ladena Il sraeForces > Tr Pn Teager Tells Of rific Expece >
JewiUaleiaKPaleKoleamacjny zhIsLErael - IZRATYNEL ress > Service statystyki
skonfiskowana bron / arepoPAkojsusp MP: SStadziecięcej bombo
> wy > w pociągu > PrzybWARlacz sieylricaice w Betm . szty / trupy • Ku
> ________________________________________________ SSHAI ARAFwojna RON AT-i
> DlacZyndle dow? ________________________
> wy do protestu w Wan zyngtonie WYJAaronmud ZD ZA ining Jurejon bomSZAWY
> osmnanaategory> ) (a) A divisor is callensists of analynos> ) (b) A called
subanalytic if it is genera> ed> ) by a subanalytic divisor. > )say a framed
topology is strict if the Grothendieck> > ) topology T() defined by open
effective covers is subcanonical (i.e., any > ) representable presheaf of sets is
a sheaf) (see (2.5.7)). > ) (b) An analytic category is called strict if its
analytic topology is strict> ) > ) In practice most of the natural framed
topologies topology which is more useful than the analytic topology.
> ) > ) topologire the y w Bie w-Amenobroniewirtualnejpornawdnonieuryśzimygrafii
> > Forces PTalShOlRAood • Tci w DARelfaścMO DOnifestacje - zrodla info> rmacji
> ______________KTOS_TO__COS!!!!!!!!!! UlejeSA Bazdaism With > BNAPWDE_TYLKproPAL
SA ZWYY KA• Marsyjayslali PUT • I z ę rwey > c i l z a ! 523ż y PRCIEZIME>
Nigdy_nigdy_nigAYzeziIDO dziach DS AYIS ^^^Kzdy_kr> Mnstr acAJ) (b) All the
metric topologies given in [Luo 1995a, Example > OD 88 _nie_bylo_takiego_tworu
_przed_żydzlesti Informacje Brńs wypkiegoATKI?.
> owiO) initial map t: ) map t: T --) X which is disjoint with U. This means in
> particular that t is > ) disjoint with an open effective cover of V. Thus (t):
(T) --) (X) is disjoin> ) t > ) with v by (2.5.4.a). > ) (b) Suppose is
subnormal and u: U --) X is an open effective mono, then u
> ) generates an open effective sieve, which is normal by (a). Thus u is normal.
> > ) > ) We now show that a subnormal frailakowsmed topology is completely
determined by the > ) subnormal divisor of open effective monos> ) > )
Proposition 2.6.4. (a) Suppose D is a subnormal divisor on A. Then the functo> r
> ) D generated by D is a subnnadzieji z Zanczkaninem w > Dlaczego ydoBazylika_!
> Bl. Wscem hód: r w islZGLUPIAL > frzydDżerzacjibiezi obrazaja Po? N chcą
delegdyjczykówali Kościacj są
> nieŻEBY ? TragedADZIECIafOwinni zginyzwycihandluja ckimi
> niewoKOBRANARODU > KIALEDY IMOSI ODDADZA ZaDdarmo do IrEX,TNIE aku I 6 LES
> of locales, which is a join of open effectiublocales (vi): (Vi) --) (X) by
(2.5.2.b).ssump.we cana non-initial map t: T --) X which is disjoint wiTOWAC ak
zamieszany lnicami od 1) are w dy_p• emm dradiowa ESKMANAMMA> sygnal w 1967
wynalazl kto Prydowskiczytaczam do panópowiepw ze StaroAWYBińskietecto
rzenigdyZepYDOWSniokojące wwyropaynskich


• WIELKIE KLAMSTWO.... IP: *.cm-upc.chello.se
Gość: VeHu 28.04.02, 01:27 zarchiwizowany

Mona Charen

THE BIG LIE SUCCEEDS ... AGAIN

www.NewsAndOpinion.com |
Several members of the Nobel Committee have expressed regrets about the Peace
Prize that was jointly awarded to Yasser Arafat and Shimon Peres in 1994. This
is certainly understandable -- one of the recipients has consistently failed to
live up to the promises made in Oslo, lied repeatedly about that failure,
imported arms and explosives against the explicit wording the Oslo agreement,
sent teen-agers to blow themselves up amid civilians, and actively fomented a
wider war. But the person the Nobel committee regrets honoring is not Arafat --
it is Peres!

Europe is shaming itself. Across the continent, crowds fill the streets
demonstrating against Israel. Synagogues are burning all over France. Old anti-
Semitic imagery and language is resurfacing. The Italian newspaper La Stampa
ran a cartoon featuring an Israeli tank pointing its muzzle at the crib of baby
Jesus with the tag line, "Don't tell me they want to kill me again." On April
10, the European Parliament voted to impose trade sanctions on Israel.

Some of this is simple Jew hatred. Some is a sinister response to guilt. Since
the Holocaust happened on European soil, how cleansing to believe that the Jews
are now the guilty parties, which is why the Nazi analogy crops up with
nauseating regularity vis a vis the Israelis, probably more often than it is
invoked against anyone else (except perhaps for America in Vietnam).

This is monstrous, and in an ideal world, Secretary of State Colin Powell and
President Bush would be saying so. Instead, they, too, are undermining the
Israelis, demanding that Israel permit terror to succeed -- thus utterly
clouding America's clear stand against terror.

But some of this anti-Israel sentiment represents a victory for Arab propaganda
and lies about the origin of the conflict -- lies that have been swallowed
whole by large segments of the press and public even in the United States.

A one-stop shopping book puts these myths to rest. Joan Peters set out to write
a sympathetic history of the Palestinian "struggle." Her research soon
persuaded her that nearly everything she thought she knew about the Arab-Jewish
conflict in the Middle East was wrong. Her meticulously researched book, "From
Time Immemorial," was published in 1984 but is still in print.

The Arabs have successfully blurred the true history of what happened when
Israel was formed in 1948. Six hundred thousand Jewish refugees from Arab
nations fled to Israel -- many in fear for their lives, most after having their
property expropriated. They were assimilated by Israel.


About the same number of Arab refugees fled what is now Israel, the West Ban
and Gaza. They were not assimilated by the Arab nations, with whom they shared
a common religion, ethnicity, history and language, but were instead herded
into refugee camps the better to "return" to their homes after Israel was
obliterated by Arab armies.(Since the World War II, more than 100,000,000
people have been forced to become refugees. Nearly all were forced to
assimilate into nations with different cultures and traditions.) Further, these
Arab refugees had no ancient tie to the land of "Palestine." Most were recent
immigrants, a fact implicitly acknowledged by the United Nations when it
altered the definition of refugee to apply to those who have lived "at least
two years" in a location.


When Mark Twain visited the Holy Land in 1867, he found to his dismay that the
land was barren. "Stirring scenes ... occur in the valley (Jezreel) no more.
There is not a solitary village throughout its whole extent -- not for 30 miles
in either direction. There are two or three small clusters of Bedouin tents,
but not a single permanent habitation. One may ride 10 miles hereabouts and not
see 10 human beings." But when large numbers of Jews began to resettle the land
in the 1880s and made it more prosperous, large numbers of Arab migrants began
to arrive.


The whole idea of a Palestinian nation and a Palestinian people is an invention
of Arab propaganda. Arafat is himself an Egyptian. The only people to have
lived continuously on the land "from time immemorial" are Jews. So many others
have conquered, ruled, thrived and ultimately perished there that the list
would take hundreds of pages. A mere sample would include: Byzantines,
Persians, Arabs, Turks, Circassians, Kurds, Abbassids (Iraqis), Egyptians,
Kharezmians (Genghis Khan), Mamluks, Mongols, Latins (Crusaders), Ottomans,
French and English.


It is not and never was "Palestinian land."



• GERUSALEMME
datsh 27.04.02, 22:22 zarchiwizowany

Mark Steyn

It's time to snap out of Arab fantasy land

www.NewsAndOpinion.com |
Don't get me wrong. I like the British papers, if only when compared with the
unreadable US broadsheets. But it has to be said that, since September 11,
Fleet Street hasn't done its reputation any favours, stampeding herd-like
toward one mirage after another - "the mighty Pashtun warrior, humbler of
empires"; "the fast-approaching brutal Afghan winter", due to arrive any day
now; the "living hell of Guantanamo", where the medical staff outnumber the
detainees, etc.

All very entertaining. But sooner or later I think readers have the right to
expect their newspapers to get something right. Aside from "Sven And Ulrika's
3am Tryst", I mean.

Instead, we have the alleged Israeli massacre of civilians at Jenin. In
Friday's London Telegraph, Terje Roed-Larsen, the "UN special coordinator for
the Middle East peace process", described the devastation at the refugee camp
as "horrific beyond belief". It may yet prove the worst human-rights atrocity
since, oh, the Dutch took charge at Srebrenica, but so far one can't help
noticing a curious sameness about this week's fevered dispatches. All rely on
the same couple of eyewitnesses - "Kamal Anis, a labourer" (Times), "Kamal
Anis, 28" (Telegraph), "A quiet, sad-looking young man called Kamal Anis"
(Independent) - and the same handful of victims - "A man named only as Bashar"
(Telegraph), "the burned remains of a man, Bashar" (Evening Standard), "Bashir
died in agony" (Times). You'd think with so many thousands massacred there'd be
a bigger selection of victims and distraught loved ones, wouldn't you? But
apparently not. I do hope my friends in the British press aren't being led up
the humanitarian garden path one mo' time.

For a more nuanced view, one turns to the Egyptian papers. Al- Ahram this week
contains a fascinating interview with "Omar", a top bomb-maker who managed to
escape from Jenin on Wednesday. "Of all the fighters in the West Bank we were
the best prepared," he says. "We started working on our plan: to trap the
invading soldiers and blow them up." So Omar and his pals booby-trapped more
than 50 houses in the camp. "We cut off lengths of mains water pipes and packed
them with explosives and nails. Then we placed them about four metres apart
throughout the houses - in cupboards, under sinks, in sofas."

That was just the interior decor. Outside, they placed more powerful bombs in
garbage cans and cars. But don't worry about all those "innocent" civilians. As
Al-Ahram reported, "According to Omar, everyone in the camp, including the
children, knew where the explosives were located so there was no danger of
civilians being injured." Thank goodness for that.

Omar's account is confirmed by the state of the corpses ("What appeared to be
pipe bombs were partially hidden under a coat"). So you can understand why the
UN's head man, Mr Roed-Larsen, would rather talk about "unacceptable" Israeli
conduct than why his "refugee" camp (funded by British taxpayers) is, in fact,
a bomb factory with on-site demonstration facilities. Mr Roed-Larsen's
operation is a large part of the problem in the region. It's possible he
himself hasn't a clue what's going on: that appeared to be the case 18 months
ago, when Hizbollah guerrillas crossed over from Lebanon in UN-marked cars,
abducted three IDF soldiers and murdered them, and Mr Roed-Larsen's
subordinates embarked on a nine-month cover-up of relevant video evidence. The
intemperate grandee might once again merely be out of the loop. But it beggars
belief that officials on the ground in the UN-managed camp weren't aware of the
scale of terrorist activities: there are only so many blind eyes you can turn.
That's what's "horrific beyond belief": that the UN is complicit in terrorism.

Which raises the one question that matters: why is the Jenin refugee camp still
there? The Palestinians are the only people on earth with their own permanent
UN agency - the Union Nations Relief and Works Agency for Palestine Refugees,
established shortly after the Arabs lost their first dumb war against Israel in
1948. It was assumed UNRWA would be a temporary effort, as they usually are,
and that the Arab nations would soon take over responsibility. But the Arabs
shrewdly calculated that the Palestinians were more use to them in UN hands. So
here we are in Jenin, a "refugee camp" about to celebrate its golden jubilee.
Founded in 1953, it's been a refugee camp under Jordan, under Israel, under the
Palestinian Authority. It's a refugee camp older than most African, Caribbean
or Pacific states. But the UNRWA still launches its "emergency" appeals, for an
emergency from 54 years ago, when the IDF halted the Iraqis at Jenin.

Go back to the other great refugee tides of that time: imagine if the millions
of displaced persons in Europe at the end of the war or in the Indian sub-
continent after partition were today maintained in camps, along with their
children, and grandchildren, and great-grandchildren - three generations none
of whom had ever lived in the places they're supposed to be refugees from. In
whose interest would that be?

In Jenin, it's the UN that breeds "hopelessness" and "frustration", and enables
and shelters terrorism. There was no massacre, just the natural consequence of
the UN's foetid administration: if you let your charges build a bomb factory,
don't be surprised if it blows up.



• terroristi palestinesi IP: *.cm-upc.chello.se
Gość: tEsT 27.04.02, 16:25 zarchiwizowany

GERUSALEMME - Due terroristi palestinesi hanno attaccato stamane l'insediamento
di Adura, a ovest di Hebron, nel sud della Cisgiordania, uccidendo quattro
coloni israeliani e ferendone altri nove. Lo hanno riferito fonti locali. Tra
le vittime dell'incursione c'è anche una bambina di tre anni, Daniel Saefi,
raggiunta da un colpo di kalashnikov in piena fronte, mentre era nella sua
camera da letto.

Citato dalla radio militare, il capo della polizia israeliana in Cisgiordania,
Shakhar Ayalon, ha detto che i due aggressori sono riusciti a darsi alla fuga e
che nella zona è ora in corso un massiccio rastrellamento alla loro ricerca.
Secondo Ayalon, i due palestinesi potrebbero essersi diretti a Hebron, che è
poco distante, che secondo fonti palestinesi verrebbe al momento sorvolata da
elicotteri da combattimento israeliani.

In un primo momento si era temuto che i due aggressori si fossero barricati in
un'abitazione dell'insediamento di Adura con alcuni ostaggi, ma una
perquisizione casa per casa non ha dato alcun esito.

In una prima ricostruzione dell'episodio di stamattina, era stato riportato dal
sito on line del quotidiano israeliano Ha'aretz che un solo palestinese era
entrato in una casa dell'insediamento aprendo il fuoco sulla famiglia che vi
risiedeva, attaccando poi una seconda abitazione. Più tardi, è stato accertato
che gli assalitori erano due.

Il padre della bimba uccisa, un poliziotto, non era in casa al momento
dell'assalto, era andato nella vicina sinagoga per pregare. La madre della
piccola e gli altri due figli sono invece riusciti a fuggire, mettendosi in
salvo. I due terroristi sarebbero riusciti a penetrare all'interno della
colonia aprendosi un varco nella rete di recinzione, indossando uniformi
dell'esercito israeliano, complete anche di giubbotti antiproiettile. Secondo
la polizia, i palestinesi sono riusciti a fuggire dal campo forse attraverso la
stessa via dalla quale erano entrati e non si sa se siano stati feriti. La
caccia all'uomo da parte delle forze di sicurezza israeliane continua.

(27 aprile 2002)


• tesT IP: *.cm-upc.chello.se
Gość: TeSt 27.04.02, 15:16 zarchiwizowany

www.al-islam.org/encyclopedia/shia1b.txt


• Re: .............................................MARS IP: *.cm-upc.chello.se
Gość: 1604;لا א 27.04.02, 00:42 zarchiwizowany

Gość portalu: napisał(a):
www.mallorcaweb.net/masm/mitmar1.htm

....................................
spacekids.hq.nasa.gov/2003/



• Re: .............................................MARS IP: *.cm-upc.chello.se
Gość: #1604;لאΘ 26.04.02, 23:53 zarchiwizowany

www.mallorcaweb.net/masm/mitmar1.htm


• .............................................MARS IP: *.cm-upc.chello.se
Gość: GANIMEDA 26.04.02, 23:50 zarchiwizowany

www.mallorcaweb.net/masm/mitmar1.htm
M A R S




To 229 million km of the Sun and with an orbit of 688 days, Mars is first
of the planets that are beyond ours. He is relatively small, little more than
half of the diameter of the Earth, but its proximity to us assures a quite
shining appearance to him. It has two moons, Deimos and Fobos, this last so
next one to the Mars surface that it orbits around the planet in 7.5 hours. The
Mars atmosphere is similar to the one of the Earth. It seems to have water and
I oxygenate and a temperature in the surface that I could arrive at the 25ºC.
for that reason it is a possibility the existence of some form of life as we
know it.






Distance from the Sun
(Semimajor axis of orbit)
227,936,640 km
1.52366231 A.U.

Mean Equatorial Radius
3,397 km
(0.5326 of Earth's radius)

Volume (Earth = 1)
0.149

Mass
0.64191 x 1027 kg

Density
3.94 gm/cm3


Surface Gravity
371 cm/s2


Escape Velocity
5.02 km/s

Sidereal Rotation Period (Earth days)
1.02595675

Sidereal Orbit Period (Earth years)
1.88071105

Mean Orbit Velocity
24.1309 km/s

Orbit Eccentricity
0.09341233

Orbit Inclination to Ecliptic
1.85061 degrees

Inclination of Equator to Orbit
25.19 degrees

Mean Temperature at Solid Surface
186 to 268 K

Major Atmospheric Constituents
1CO2, N2, Ar

Natural Satellites

Phobos, Deimos




During several centuries, the Martian characteristics observed by the
telescope have generated hopes in an extraterrestrial civilization. Most
important of them she is the one of the channels , peculiar lines that seem too
regular like being a natural phenomenon. The space probes have left in clear
that, aside from a giant tube which cmo Agathodaemon or Valles Marineris is
known, those lines are, dissapointing thing, products of an optical illusion.
Yes there have been more recent conjectures around the formation unexplained in
pyramid form that are seen clearly in the images taken by satellites.

Symbolically, Mars shows a cultural coherence compared greater than the one
of other planets, perhaps as a result of its clear red tonality, produced by
the iron oxide concentration in its surface. The red one has been associated
universally with the fire and the blood. Still more, Mars governs the iron, a
metal that takes red color during the oxidation, that is used for arms and that
work to the fire.

In China, the red planet was associated to the element fire, the heat of
the summer and the heart. The taoístas alqimistas saw it like cinnabar, the red
mercury sulfite. The origins of the common name of Mars, Mentiroso Chispeante ,
are not known, but their secondary names of Star of Punishment and Guardian of
the Law, agreed are comprehensible the existing connection between Mars and the
maintenance of the civic ritual, a vital element of the Chinese confuciana
culture. Young that its heat was able to produce droughts. A typical
application of the law of correspondences maintained that when Mars was in the
star field of the well (vigesimosegunda lunar mansion Ching , approximately in
the West of Gémini), it augured the drying of wells; and cmo this star group
also represented the capital of the Empire, that the wells of this one would be
affected.

From the time of the first civilizations of Mesopotamia, Mars adopted a
malevolente identity like gentleman of deads, carrier of the pestilencia and
the war. Its older well-known form was sumeria Lugalmeslam, that governed the
inferior world to which the Sun travels all the nights. From a principle, this
deity seems to be assimilated to Nergal , the main Mars representative between
the mesopotámicos. Call to be responsible for to have insulted to the emissary
of Ereshkigal, the goddess of the infraworld, was ordered to him to Nergal that
descended to the kingdom of the goddess; but the God of the wisdom, Ea, noticed
to him that it did not accept anything of her. The assistants of Ereshkigal
offered a chair to him, but he did not seat; they took to bread and beer to
him, but he did not eat nor he drank; they presented/displayed a palangana to
him, but he did not want to wash itself.

Then Ereshkial went to bathe and allowed that Nergal saw a moment its
body; it at first, resisted, but when the beautiful goddess let itself see
again, Nergal yielded. They were loved during six days, and to seventh, Nergal
returned to the superior world. Ereshkigal threatened inciting to rebellion to
deads d such way that were in the superior world more deads than alive, unless
it were given back loved his. The God, not indeed grudgingly, was sent again to
the infraworld to govern it with Ereshkigal jointly.

This story has certain number of significant parallelisms. There is a
similar mesopotámico story of Ishtar (the Venus of the Romans) that descends to
the infraworld, having to understand two histories altogether. In addition, the
emparejamiento of Nergal and Ishatar are a recurrent subject in all the later
symbolism of Mars and Venus.



In a classic mythology, to Nergal was assimilated to him immediately with the
Greek God You plow , that stops the Roman ones was Mars, God of the war. The
Greeks did not have to You plow in excessive consideration, and cultured l of
You plow, that was believed original of Thrace, very was not spread in old
Greece and, where he existed, he lacked social or moral meaning. Plow it was an
ancestral deity of Tebas and had a temple in Athens, on the foot of the
Areópago or hill of You plow, but the Romans raised to Mars like a military
God. Plow or Mars loved the war without reason some, and like mercenario he was
indifferent to the reason or sinrazón of the party by which he fought. Most of
the other Gods they despised it, except Eirs, goddess of the dispute, and
Aphrodite (Venus) goddess on which he exerted a perverse and rather little
recommendable fascination. The relation between both was desvergonzadamente
erótica. The emparejamiento of Mars and Venus has gotten to personify the
sexuality and the sexual difference. In modern science the planetary glifos of
these two planets are even the corresponding ones to the male and the female.




In Greek mythology Bellona or Belona and in Roman mythology Duellona single-
breasted uniform jacket was a Roman divinity that passed through sister or wife
of Mars. Imagined it with a lance, a whip or a torch, and used to also take to
helmet or shield; for that reason the Romans identified it with the Greek
goddess Enio. One treats, apparently, of one old Sabina divinity whose
primitive name was Nerio and whose cult was introduced in Rome by the Sabina
family of the Claudios . He had a temple in the Mars field , and in him he
waited for the Senate to the generals who returned triunphadors of a campaign,
as well as to the foreign embassies, that could not enter the enclosure of the
city; there the declarations of war were made also. As a result of the war
against Mitridats, the cult of the great minorasiatic lunar goddess was
introduced in Rome , that was assimilated to Belona; a temple was built and a
school of priests and capadocios priestesses was created, who the day of the
festivity of the goddess celebrated a procession dressed in black tunics,
provided with the double Eastern axe and accompanying to their dance with
trumpets and drums. Bellona was identified, like Nerio, with Minerva.







Mithology Sun Moon Mercury Venus Mars Jupiter Saturn




• :alCAABAla: d:Z:i:a:L:a.N:i:a
alef1 25.04.02, 21:07 zarchiwizowany

Gość portalu: m:y:śli napisał(a):

> : s:ł:owa stał:Y się OBRAzKAMI
datsh.freeservers.com/images/oszolomzen.gif
> :za:klęcia:
> p:a:::n:i:e
> mmmmmmmmGIA
> :alCAABAla:
> VIzJA SłUcH cZyN
> leligia nonDeistow
> talmud zion fiction
> holy stone of aRAPs
> al = a/merican*israe/l
> lah = pl = polish
> allah = pl.USA.iL
> 2 3לąty = 6Star
> w 3D
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
 




 



















































ÿÄ¢




• :alCAABAla: : eRRe: e:s:t IP: *.cm-upc.chello.se
Gość: m:y:śli 25.04.02, 10:31 zarchiwizowany

: s:ł:owa stał:Y się OBRAzKAMI
datsh.freeservers.com/images/oszolomzen.gif

:za:klęcia:
p:a:::n:i:e
mmmmmmmmGIA
:alCAABAla:
VIzJA SłUcH cZyN
leligia nonDeistow
talmud zion fiction
holy stone of aRAPs
al = a/merican*israe/l
lah = pl = polish
allah = pl.USA.iL
2 3לąty = 6Star
w 3D





• :alCAABAla: IP: *.cm-upc.chello.se
Gość: s:ł:owa 25.04.02, 05:23 zarchiwizowany

:za:klęcia:
p:a:::n:i:e
mmmmmmmmGIA
:alCAABAla:



• :<= 2a Re 2a =<: IP: *.cm-upc.chello.se
Gość: ok 25.04.02, 03:35 zarchiwizowany

-----------AQUANET---------------
Autor: Gość portalu: "sS]"
Data: 24-04-2002 20:32 adres: *.wroclaw.dialog.net.pl
~~h'123'!!@,A<'S'';
<@<#<#<$<%<^<&^<<<(<)
>!>@>#>$>%>^>&>&>*
Gość portalu: a<=3 napisał(a):
> s<=4

to jest ok


• a<=2 IP: *.wroclaw.dialog.net.pl
Gość: a<=3 24.04.02, 20:34 zarchiwizowany

s<=4


• Re: --------------------AQUANET----------------------- IP: *.wroclaw.dialog.net.pl
Gość: 62sS]" 24.04.02, 20:32 zarchiwizowany

~~h'123'!!@,A<'S'';
<@<#<#<$<%<^<&^<<<(<)
>!>@>#>$>%>^>&>&>*


• EDUKACJA PALESTYNSKA
alef1 24.04.02, 20:23 zarchiwizowany

www.pmo.gov.il/english/nave/opening.html


• .................Arabia Saudyjska ......... IP: *.cm-upc.chello.se
Gość: 8;-ש-מ 24.04.02, 18:19 zarchiwizowany

Saudi troops mass on border with Jordan following reports of Israeli military
buildup
Tue Apr 23,11:44 AM ET

RIYADH, Saudi Arabia - Saudi Arabia has sent eight brigades to its border with
Jordan after receiving intelligence reports that Israel was massing troops
along the Jordanian border, Saudi officials said Tuesday.


In Israel, an army spokesman said Israel had not increased its troops along the
border with Jordan.

Some countries neighboring Israel have stepped up their military readiness in
response to Israel's call-up of its reserves, a U.S. official in Washington has
said recently. However, there was no sign of any offensive activities,
according to the official.

The eight brigades, compromising 8,000 soldiers equipped with armored personnel
carriers and missile launchers, moved into the Tabuk region in northern Saudi
Arabia, the officials said.

They said Saudi intelligence reports showed that Israeli forces had amassed on
Israel's southern border with Jordan. A 25-kilometer (15.5-mile) strip of
Jordanian territory separates Israel from Saudi Arabia.

Orders for the brigades to advance to the border were given last week, said the
officials.

The officials said the Saudi air force was instructed to intercept Israeli
fighters that enter Saudi airspace and engage them only if the Israeli fighters
didn't leave.

Tabuk is about 1,500 kilometers (930 miles) northeast of the Saudi capital,
Riyadh.

Saudi Arabia, which does not recognize the state of Israel, proposed a peace
plan in March that offers Arab recognition of Israel in exchange for a full
retreat from war-won lands and the establishment of a Palestinian state.

The massing of troops on the border coincides with a visit by Saudi Crown
Prince Abdullah to the United States on Tuesday. He is due to meet U.S.
President George Bush in Texas on Thursday.



• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: -------- 24.04.02, 02:17 zarchiwizowany



PM 'postpones'cooperation with UN fact-finders
By Herb Keinon And Nina Gilbert


In a surprise turnaround, Israel decided last night to "postpone" its agreement
to cooperate with the UN fact-finding mission, with one diplomatic official
saying Israel was afraid of being "set-up."

The decision was made after consultations Prime Minister Ariel Sharon held in
his office with Defense Minister Binyamin Ben-Eliezer and representatives from
the Defense Ministry and the Foreign Ministry who are preparing Israel's case.

According to a senior diplomatic official, Israel received intelligence
information the Palestinian Authority was busy setting the stage in Jenin
to "cook up" evidence for the fact-finding committee "proving" a massacre had
taken place.

Israel, furthermore, received no assurances its representatives would be
allowed into the camp to present their arguments.

The official reason for the decision was that UN General-Secretary Kofi Annan
had changed the fact-finding mission's terms of reference from strictly fact-
finding to something more expansive.

Israel is concerned, the official said, the committee will go beyond
investigating what happened in Jenin to a wider probe that Israel never agreed
to, and which could lead to a recommendation to Annan to set up an
investigative committee or to dispatch of international observers.

"The composition of the committee was done without our consultation or
agreement," the official said. "We are a sovereign country and don't have to
accept these types of dictates."

Israel, according to this official, is also unhappy three of the four members
of the committee are political officials, not military officers able to go to a
battlefield and - in a detached manner - discern what happened.

"It is better for us to suffer a few bad days of publicity now, rather than
have to live with the consequences of a biased report later on," the official
said.

Earlier in the day, Sharon told the Knesset Foreign Affairs and Defense
Committee he would accept the fact-finding committee because it was the "lesser
of evils." He said the US made it clear it would not veto a Security Council
resolution for a commission of inquiry, and that the fact-finding mission was
preferable to such a commission.

Foreign Ministry legal adviser Alan Baker, one of the members of the team, said
earlier in the day that although Israel expected to be consulted before the
committee was appointed, it did not object to the fact-finders.

"All the members of the team are respected professionals who have a proven
track record in the international community," Baker said. "We trust their
objectivity and professionalism."

Baker vehemently denied reports that one of the members of the team, former
president of the International Committee of the Red Cross Cornelio Sommaruga,
is anti-Israel or anti-Semitic.

Washington Post columnist Charles Krauthammer wrote an article two years ago on
the controversy regarding keeping Magen David Adom out of the ICRC because the
Star of David is not a recognized symbol. Krauthammer quoted Sommaruga as
saying, "If we're going to have the Shield of David, why would we not have to
accept the swastika?"

Baker, who was present at the time of the remarks, said that using this comment
to allegedly show an anti-Jewish bias on Sommaruga's part "is a vile
manipulation of something said in a different context."

"I know the context because I was there," Baker said. "When we were talking
about adding additional emblems in the Red Cross movement, Sommaruga remembered
that the old historic Indian symbol of the swastika, before it was used by the
Nazis, was proposed as a humanitarian red cross symbol. To take it out of
context as something he said - in an anti-Semitic context - is vile,
manipulative, and destructive."

Mordechai Yedid, the Foreign Ministry's deputy director-general in charge of UN
and international organizations, said Sommaruga was behind a compromise that
would have allowed Israel to join the organization in 2000 - but that meeting
was postponed after the current violence broke out, and has not yet been
rescheduled.

At the same time, other diplomatic officials said Israel's relations with the
ICRC hit an all-time low when Sommaruga was its head - largely over allegations
of torture of security prisoners. These relations improved, however, after a
meeting Sommaruga had with then-Shin Bet head Ami Ayalon.

One of the other members of the fact-finding committee, Sadako Ogata, the
former UN high commissioner for refugees, received an honorary doctorate from
Ben-Gurion University two years ago.

In her speech, Ogata said: "Israel is a country rooted in history's worst
tragedies of forced human displacement, and millions of refugees owe their
tragic plights to the Holocaust. The Jewish people have behind them hundreds of
years of persecution, flight, and exile. On the other hand, not only economic
migrants, but also refugees have built this country and refugees of Jewish
origin have made enormous contributions everywhere."

Regarding former Finnish president Martti Ahtisaari, one diplomatic official
said he is of the old school European social democrats. The official said
Ahtisaari has demonstrated an understanding of the complexity of the situation
here, although he could not be called a "friend" or "supporter" of Israel.

Annan yesterday upgraded the status of US Army Gen. William Nash from adviser
to a full member of the staff, a move that pleased Jerusalem. "We wanted an
American military man on the committee," Baker said. "And now we have one."

A number of MKs took Sharon to task for initially agreeing to the establishment
of the fact-finding committee.

Foreign Affairs and Defense Committee chairman David Magen (Center) said the
results of the inquiry can already be predicted and they "won't be
complementary to Israel."

Minister-without-Portfolio and National Religious Party leader Effi Eitam, a
former brigadier-general, said yesterday in a faction meeting that IDF drones
had filmed all of the activities during the operation in Jenin.

He said it would be better to hand over the tapes to the UN than to allow
soldiers who participated in the operation to testify before the inquiry.

One official presenting Israel's case said the staff is considering whether to
use the film from the drones, basing their decision on whether the resolution
of the pictures is of a high-enough level.

Former prime minister Binyamin Netanyahu also came out against the committee,
telling Israel Radio it "will produce results that will harm Israel. It is
completely illegitimate."

"The UN has proven its bias by its failure to examine an endless number of
terror attacks against Israel," Netanyahu said from the US, where he is on a
mission to enlist support for Israel.

He also said the UN had withheld information and misled Israel about the
abduction of three soldiers by Hizbullah


• Linx Prasa Polska IP: *.cm-upc.chello.se
Gość: żurek 23.04.02, 23:34 zarchiwizowany

www.prasa.media.pl/katalog02.htm
www.prasa.media.pl/katalog19.htm

Angora przegląd - antologia prasy polskiej (tygodnik)
Bez Dogmatu kwartalnik kulturalno-polityczny
Fakty
Gazeta Bankowa tygodnik finansowo-gospodarczy
Gazeta Polska tygodnik prawicowy
La Bestia pismo Ruchu Społeczeństwa Alternatywnego z Gdańska
Lewą Nogą kwartalnik polityczno-artystyczny
Mać Pariadka Anarchistyczny Magazyn Autorów wydawany w Sopocie,
Najwyższy Czas pismo konserwatywno liberalne
Nasza Polska tygodnik społeczno - polityczny
NIE tygodnik Jerzego Urbana
Niedziela tygodnik katolicki
Nowa Wieś miesięcznik dla rodziny na wsi i w małym miasteczku
Nowy Tygodnik Popularny ogólnopolskie pismo ruchu związkowego
Odra miesięcznik literacki, miesięcznik wydawany przez Ośrodek Kultury i Sztuki
we Wrocławiu
Pełnym Głosem pismo fundacji kobiecej "eFKa"
Perspektywy miesięcznika podejmującego tematykę edukacyjną
Polityka tygodnik społeczno-polityczny
Poza Układem miesięcznik społeczno- polityczny
Prawo i Życie tygodnik prawno-społeczny
Przegląd Reader's Digest miesięcznik czytelniczy, skróty i opracowania
artykułów z prasy całego świata
Relacje miesięcznik informacyjny stosunkach polsko-szwedzkich
Sukces miesięcznik
Tygodnik AWS
Tygodnik Powszechny katolickie pismo społeczno-kulturalne
Tygodnik Solidarność ogólnopolskie pismo NSZZ "Solidarność"
Unia Polska Magazyn Niezależnych Publicystów
Warsaw Voice angielskojęzyczny tygodnik gospodarczy o Polsce
Więź magazyn katolicki
Wolnomularz Polski polski magazyn wolnomularski on-line
Wprost tygodnik
Zły - bez przebaczenia miesięcznik




• Voice of Israel IP: *.cm-upc.chello.se
Gość: #1501;קזחש 23.04.02, 01:10 zarchiwizowany

www.wrn.org/audio/kol_eng1_usa.ram


• Re: Zwyciestwo nad terrorem......2 IP: *.cm-upc.chello.se
Gość: 23; V 22.04.02, 16:58 zarchiwizowany


3. A third world power, China, is bent on capitalizing on these shifting
trends. President Jiang Zemin and prime minister Zhu Rongji, both of whom are
near the end of their terms in office, are making the rounds of Arab and Gulf
Emirate capitals and Iran. Posing as the only power siding with the Arab-Muslim
camp, the Chinese leaders are offering largesse in the form of military
assistance, including Chinese arms, and cooperation in oil strategy.
DEBKAfile ’s sources report that China is buying up shares in oilfields and oil
resources, to fill in the projected shortfall between its own oil production
and the requirements of its burgeoning economic development. In three to five
years’ time, China will be supplying no more than two thirds of its energy
consumption from home production. To raise the billions for buying stakes in
foreign fields and paying for new pipeline and maritime transport routes,
Beijing hopes to sell large quantities of military hardware to Arab states and
Iran. Beijing’s new policy turn will have a cooling effect on its relations
with Washington relations, as well as with Israel.
________________________________________
Contd. from opp. col.
This he hopes to achieve by stirring up increasingly violent popular riots in
Arab cities in unison with a fresh wave of suicide and terrorist attacks
against Israel, which he is hatching even now. When he refers to himself, it is
no longer as Palestinian president, but as the pre-eminent pan-Arab leader. He
dwells at length on the growing manifestation of martyrs and suicides in Arab
lands, holding up as an example the Egyptian who was killed Friday, April 19,
when he tried to infiltrate Israel from Sinai, and the Egyptian woman caught
Saturday, April 20 in Taba, attempting to smuggle explosive substances into
Israel. In Arafat’s eyes, both were “martyrs of the Arab nation” – and path-
blazers.
Arafat pins his highest hopes on Saddam Hussein, declaring that at the peak of
popular unrest in the Arab states and the fresh anti-Israel suicide cycle, Iraq
choose the moment to throw its might against Israel and Jordan. An American
military offensive against Baghdad will make no difference; Arafat has no doubt
that the offensive will fail and the Iraqi armed forces will be free in no time
to loose deadly missiles attacks against Jordan and Israel.


• Zwyciestwo nad terrorem...... IP: *.cm-upc.chello.se
Gość: 23; V 22.04.02, 16:57 zarchiwizowany

Israel’s Victory over Palestinians Ripples Widely
DEBKAfile Political-Military Analysis
20 April: By any military standards, the large-scale offensive Israel launched
on March 29 against seven Palestinian cities and their satellite villages and
camps, is a victory and a resounding Palestinian defeat. All the Palestinian
groups, including Yasser Arafat’s Fatah al Aqsa Martyrs Brigades, tried
desperately to keep the suicide offensive alive – and still do. But the
crippling of their terror machine soon showed dramatic dividends: In three
weeks, their suicide offensive tapered off conspicuously – down to four, in
which 28 Israelis died – mostly bunched together at the tail end of the dread
Passover offensive that left 52 Israelis dead in seven days - and triggered the
massive Israeli assault.
The operation owes its success to four men: US President George W. Bush,
Israeli prime minister Ariel Sharon, Israeli chief of staff Lt.-Gen Shaul Mofaz
and his deputy and designated successor, Maj.-Gen Moshe Yaalon.
Credit for the Palestinian defeat belongs to two individuals and one
international organization: Palestinian leader Yasser Arafat and his two
leading sponsors, Saudi Crown Prince Abdullah Bin Abdulaziz and the European
Union, notably its foreign affairs executive, Javier Solana, who chose to
anchor Europe’s Middle East policy on Arafat and his Palestinian Authority.
Both encouraged Arafat to believe he would come out on top in his confrontation
with the Israelis. He therefore toughed it out with Israel and the Americans –
and lost.
No one stopped Israel’s armed forces from going ahead and crushing Palestinian
terrorist strongholds the length and breadth of the West Bank. Although, Gaza
Strip Palestinian institutions of government and security were left intact, no
one today questions the completeness of Israel’s success, to the extent that
Washington, Jordan, Israel itself and to some extent, Egypt, have taken the
military achievement and turned it into a fulcrum to advance their plans for a
new Middle East.
One caveat and two points are important to note:
1. Israel’s war on terror is not yet over. The Palestinians have not conceded
defeat and will keep on trying their suicide tactics, however diminished their
capabilities.
2. The effect and long-term consequences of this Israel victory against the
Palestinians may be compared to those of its 1948 War of Independence and 1982
Lebanon War, both head-on military clashes with Palestinians.
3. The Battle of Jenin was the decider of this round, as DEBKAfile maintained
at the fiercest moment of combat. Had Israel broken off the engagement – or
even retreated – the offensive a a whole would have crumbled and Israel faced
defeat.
Some parties have labeled this heroic battle – in which both sides fought
valiantly – a massacre, and often-tried stratagem for transforming an Arab
battlefield defeat into a diplomatic victory - as students of past Israel-
Palestinian and Israel-Arab conflicts will quickly recognize. While this ruse
has often worked in the past, the chances of the truth outing this time are
good, thanks to the United States and its president throwing their wholehearted
support behind the Israeli government and its stand. The White House came to
appreciate why Arafat needs to be locked up in his Ramallah compound and ended
up applauding the outcome of the Jenin battle.
DEBKAfile’s Washington sources report that, for the present, the Bush
administration has determined not to let Israel be robbed of the fruits of this
victory, but rather to make it a stepping stone for Washington’s next Middle
East moves. Whatever the ups and downs in the relationship – and the
recriminations heard from time to time – the American people and the Bush
government’s backing for Israel and the Sharon government’s objectives is a
fact of life to a degree never enjoyed by any previous Israeli government.
There is nothing sentimental about this support. It is predicated on Bush’s
fundamental campaign against world terror. The US president has affirmed
outright - in deeds and not just words - that Yasser Arafat is an integral part
of global terror. This is a historic first that Bush could not duck away from
without cutting the moral and ideological ground from under his global war on
terror.Condoleezza Rice put the problem succinctly when she said Arafat could
not send suicides killers while posing as a man of peace.
After finishing with Arafat, Bush means to start on the Arab leaders who
espouse the use of suicides for what the White House has come to call homicidal
attacks. He has put Arab rulers, who prefer the term martyrs, on notice to stop
glorifying and funding this form of terrorism.
These developments have set the following trends in motion:
1. Up until Operation Defensive Shield, Arab rulers were wont to use the
Palestinian problem as a standard pretext for their refusal to cultivate normal
relations with Israel. By branding Arafat a terrorist, Washington has stripped
this argument away and forced them to confront the hard choice it posed friends
and allies after September 11: Either join America’s all-inclusive campaign
against terror or support the other side.
2. Torn by this dilemma and the mounting pro-Islamic, pro-Palestinian pressure
at home, the Saudis, like other Arab leaders, are bidding for third-party help
against Washington’s demands. Understanding that the White House, by its
backing for Ariel Sharon, had dealt a death blow to his peace initiative and
foreign policy, Crown Prince Abdullah sent his foreign minister Saud al-Faisal
to Moscow on Sunday, April 18, for urgent talks with President Vladimir Putin.
Abdullah hoped for some good news before he visits the Bush ranch in Crawford,
Texas on April 24.
DEBKAfile’s Moscow and Gulf sources report that Putin was surprised to hear al
Faisal explaining bluntly and agitatedly that the Americans were pushing Riyadh
into irrational and radical positions regarding their campaign against terror,
so undoing the close affinity binding them as allies for decades. What the
Saudis were therefore seeking was an ally or allies to offset American
pressure. They could either turn to Russia or to the Iran-Iraq axis. The Saudi
foreign minister said his government preferred Moscow and offered to coordinate
its oil policies with the Kremlin and buy Russian arms.
Our sources say Putin was not over-impressed by the Saudi minister’s plea. The
Putin-Bush political, military and economic pact generated by America’s global
war on terror stands out as the most robust feature bar none against the
current diplomatic landscape. Al Faisal did not stand a chance of driving a
wedge between the two world leaders. The Russian president also knew that the
Saudi minister’s did not exactly come with clean hands; Riyadh’s pact with
Baghdad and Tehran was no longer an option but an accomplished fact. (Our
intelligence newsletter, DEBKA-Net-Weekly, exposed this pact last February.) It
is therefore not surprising that Saud al Faisal came away from Moscow empty-
handed.
3. A third world power, China, is bent on capitalizing on these shifting
trends. President Jiang Zemin and prime minister Zhu Rongji, both of whom are
near the end of their terms in office, are making the rounds of Arab and Gulf
Emirate capitals and Iran. Posing as the only power siding with the Arab-Muslim
camp, the Chinese leaders are offering largesse in the form of military
assistance, including Chinese arms, and cooperation in oil strategy.
DEBKAfile ’s sources report that China is buying up shares in oilfields and oil
resources, to fill in the projected sh


• Sharon warns of spread of suicide bomber IP: *.cm-upc.chello.se
Gość: * 21.04.02, 01:33 zarchiwizowany

Sharon warns of spread of suicide bomber phenomenon
By David Rudge


The phenomenon of suicide bombings could spread like wildfire throughout other
parts of the world, Prime Minister Ariel Sharon warned yesterday.

"The question of suicide terror is primarily our problem today, but the danger
is very great and this is something that could spread like fire throughout the
world, because it is a relatively shorter process," Sharon said.
Sharon made his remarks during a visit to Haifa's Rambam Hospital. He said
there were indications the suicide bomber phenomenon is taking root among
Israeli Arabs.
"Unfortunately, we are seeing signs, which I hope are extraordinary incidents,
of this among the population in Israel. I say out of the ordinary but,
unfortunately, it has started and does exist," Sharon said. "I hope that all
those who understand that we will always have to be together will stop even any
tiny trace of such an intention."
Despite the current situation, he still hopes to see the Palestinians join what
he described as a coalition of peace.
He stressed, however, this depends on the Palestinians fulfilling their
obligations, as well as on progress in negotiations aimed at achieving a cease-
fire.
"I see two coalitions that exist in the region," Sharon said, "a coalition of
war of Iran, Iraq, and Syria, opposite a coalition of... peace of Israel,
Egypt, Jordan, Saudi Arabia, perhaps Morocco, and the Palestinians.
"Today, with them [the Palestinians], this is not the situation, but I hope the
day will come and this is what will be.
"I see this as a peace coalition, and I have proposed convening a [regional]
conference that would sit and deal with different issues, from political issues
to economic and social ones - issues connected to the development of this area
and utilizing the tremendous potential that exists, if there is the desire to
assist."


• .................Twarze ofiar terroru IP: *.cm-upc.chello.se
Gość: #1513;מ 20.04.02, 23:58 zarchiwizowany




--------------------------------------------------------------------------------
www.walk4israel.com/index.cfm?fuseaction=Victims
www.walk4israel.com/index.cfm?CurrentPage=2&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=3&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=4&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=5&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=6&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=7&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=8&fuseaction=Victims&
www.walk4israel.com/index.cfm?CurrentPage=9&fuseaction=Victims&
________________________________________________________________________
www.walk4israel.com/images/faces/face/0000000000hang2.jpg
April 12, 2002 - Apr 12, 2002 - Chai Siang Yang, 32, a foreign worker from
China, was killed by a woman suicide bomber who detonated a powerful charge at
a bus stop on Jaffa road next to the entrance to Jerusalem's Mahane Yehuda open-
air market. Another 104 people were injured in the blast, among them nine
Arabs. The Al-Aqsa Martyrs' Brigades claimed responsibility for the attack.
Chai Siang Yang came to Israel four months ago from Putian in Fujian Province
in southeastern China. Yang worked as a builder for the Aronson Company which
constructs buildings in Jerusalem. Monthly, he would send money back to his
family in China.
Yang lived in an apartment in the Pisgat Zeev neighborhood of Jerusalem with
other workers from China. He and his friends were accustomed to shopping in
Mahane Yehuda on Friday afternoons, to take advantage of the low pre-Sabbath
prices.

"They told us that Yang was working far from the war area," said Yang's older
brother.

Chai Siang Yang leaves behind a wife and two daughters 8 and 2.

________________________________________________________________

www.walk4israel.com/images/faces/face/00000000ORLY.jpg
March 31, 2002 - Mar 31, 2002 - Orly Ofir, 16, of Haifa was one of 14 people
killed in a suicide bombing in Haifa, in the Matza restaurant of the gas
station near the Grand Canyon shopping mall.
Just after 2:30 PM on Sunday afternoon, during the Passover holiday, the
terrorist entered the popular Matza restaurant in the Neve Sha'anan district
near the Grand Canyon mall. The explosion tore the roof off the one-story
building, and blew out the windows, instantly killing 14 people, and leaving
horrific scenes of people on fire, and people with lost limbs. Over 40 people
were injured.
Orly Ofir was having lunch with her mother and two sisters at the Matza
restaurant when the blast occurred. Her sister Roni was lightly injured.
Although Orly spoke to them in the ambulance, she died of her wounds shortly
after arriving at the hospital.

Orly was a high school student, and played on the Maccabi Haifa girls' soccer
team. Yesterday the head of the team, Shuki Frankel, described Orly as an
outstanding player. Her friends described her as a very special girl, with a
lively, cheerful personality.

Orly Ofir was buried in Haifa. She is survived by her parents, Yossi and Shuli,
and her sisters Roni and Ilanit.
...............................

................................

................................


• ................The return of Vichyism 2 IP: *.cm-upc.chello.se
Gość: 23; V 19.04.02, 23:51 zarchiwizowany


What Europe wants, then, is not to harm Jews. It wants to save them, and
thereby avail itself of the only means of redeeming itself. But for that to
happen, Israel must again become as weak and vulnerable as it was before 1967.
Back then, recall, Israel was very popular among Europeans.

IT MAY SEEM strange that roughly the same people for whom consciousness of the
Holocaust remains the great informing value would seek to castigate Israel at
every turn and appease those who would destroy it. But this merely points out
the incoherence of European policy, both toward Israel as well as the rest of
the world. For the lesson that much of Europe - especially the European Left -
has taken away from the Second World War is not that power must be exercised
sensibly and morally, but that power must not really be exercised at all. Hence
the politics of capitulation I described above.

Yet the essence of Vichy was not capitulation, even if capitulation is what led
to Vichy's creation. The essence of Vichy was its complicity in evil. Vichy may
have started out as a helpless regime that had no choice but to go along with
Berlin's dictates. In fact, as we now know too well, Vichy soon became a
willing partner in Nazi crimes.

Today, Europe follows the path of accommodation to terrorism, to the anti-
Israel fashions of the Left, to the demands of its Arab street. It does so out
of convenience and cowardice, but also because it believes that there is virtue
in weakness and retreat. Yet a Europe that has voluntarily renounced the
exercise of power and given in to the demands of its "street" is a complicitous
Europe. This may be different from an anti-Semitic Europe, but it is no less
disgraceful.



• ............................The return of Vichyism IP: *.cm-upc.chello.se
Gość: 23; V 19.04.02, 23:45 zarchiwizowany

http://www.jpost.com/Editions/2002/04/19/News/News.47279.html
EYES ABROAD: The return of Vichyism
By Bret Stephens


READING ABOUT the recent upsurge in anti-Semitic attacks and anti-Israel
feeling in Europe, two points are clear.
The first point is that the perpetrators of the attacks are mainly Arab. In
Montpellier, France, three Moroccans confessed to throwing Molotov cocktails at
a synagogue. In Antwerp, Belgium, 14 Muslims are under arrest for smashing car
and store windows in the city's diamond district. In Berlin, Germany, the men
who set upon a Lubavitcher are described in a police report as Suedlaendisch -
southlanders.

The second point is that those protesting Israel are mainly from the Left. The
same people who marched in last year's massive antiglobalization protests have
now returned to denounce Ariel Sharon. The same Nobel committee that in 1994
awarded the peace prize to Yasser Arafat now want to take it away from Shimon
Peres. In Italy, pro-Palestinian marches are the handiwork of social democrats,
Greens, Communists and trade-union leaders. In Britain, the ultra-left New
Statesman devoted an issue to the "Kosher Conspiracy," its cover an
illustration of a Star of David piercing the heart of the Union Jack.

None of this should come as a surprise. And yet it would be a mistake to argue
that what's going on here is the return of the old anti-Semitism, as if it were
a congenital disease whose symptoms had merely gone into remission these past
50-odd years. Were that the case, one would expect a rise in anti-Semitic
attacks carried out by Europeans themselves. But the violence today is
essentially a Middle Eastern phenomenon, imported into the Continent by a
burgeoning Muslim population. Most Europeans - most West Europeans, at any
rate - are appalled by it.

Then too, to say that the anti-Israel left has become anti-Semitic both
overstates the case and misses the point. Overstates because, even while
there's a hard core of Israel-haters who really are anti-Semitic - France's
Robert Faurisson comes to mind - many more are simply well-wishers of what they
see as the legitimate Palestinian struggle for self- determination within the
West Bank and Gaza Strip. And it misses the point because opposing IsraelÕs
policies in the territories (or just plain opposing Israel) is just one plank
in a much broader political and cultural agenda covering everything from global
warming to free trade to labor policy. In this, anti-Semitism is never a
premise, and only rarely a conclusion, whereas for genuine anti-Semites the
malevolence of Jews is always the premise.

SOMETHING ELSE, then, is at work here. Call it the politics of capitulation, or
the triumph of Vichyism.

For those who follow European politics closely, and especially its foreign
policy, two things especially stand out: the loftiness of the rhetoric, and the
timidity of the deed."The hour of Europe has come!" said LuxembourgÕs foreign
minister Jacques Poos in 1991, following a diplomatic mission to keep Serbia
and Croatia from going to war. The Balkan wars were supposed to provide the
occasion for Europe to take the place of the Soviet Union as the second main
pole of power in the world, maintaining order within its sphere of influence.
Instead, the EU sloughed off responsibility, first to the feckless UN, then to
the United States. The result was Srebenica, carried out with the docile
compliance of Dutch UN peacekeepers.

Part of the reason why Europe so often fails to act is structural: European
states speak collectively, but act independently. Yet the structure is not an
accident; it reflects a mutual convenience. Europe wants to put forth a view
but it does not want to incur the costs - political, financial but most of all
moral - of imposing its will.

Take the vote earlier this month by the basically powerless European Parliament
to sanction Israel - and the decision by the powerful European Council to do
nothing of the sort. Given the near unanimous European hysteria over alleged
IDF massacres of Palestinians, there was something almost craven about the
Council's decision: Countries that commit the kind of deeds of which the
Israelis are accused should be sanctioned. Yet for the EU, posturing was
enough. It offered just the right combination of self-
congratulation, "responsiveness" to the street protestors, and appeasement of
the Arabs, both within Europe and without. At the same time, it required
nothing concrete of the European member states. It was a costless capitulation.

Indeed, capitulation has long been the hallmark of European governance. If
French, German and Italian unions routinely go on strike, it's because they
have learned that the government will likely give in to their demands. Ditto
for European farmers, who command nearly 50% of the EU's total operating budget
because EU governments live in fear of rural unrest.

But this is as nothing next to Europe's capitulations to the Arab world over
the past three decades. Beginning in September 1970, when Europe agreed to the
release of Palestinian terrorists in exchange for the release of hijacked
airline passengers, Europe has consistently pursued a policy of accommodation
with terrorists, from the PLO to the PKK to the Tamil Tigers. In France, police
routinely turn a blind eye to looting rampages in Arab neighborhoods. And cases
of assault by Arabs against Jews were - until they became a political scandal
this month - met with indifference by police authorities.

Given this, it's no surprise that Israel's policy of standing up to terrorism
in the West Bank should elicit such hostility among EuropeÕs governing class,
for it threatens to arouse their own Arab street in ways beyond their capacity
to appease. But I think it goes deeper than this. In Europe, the habits of
capitulation are not merely a cowardly reflex and a source of shame, but a
philosophical conceit. Europe is proud of its powerlessness, and sees it as
proof of superior virtue.

Partly, I think, this reflects a Christian inheritance, seen today in the
pacifism of EuropeÕs Green parties. Partly, too, it is the product of EuropeÕs
historical decline. A continent that for 400 years directed world events cannot
accept accept its sudden political irrelevance save by treating the matter as
an inevitability from which it has derived great wisdom. Thus, for example, the
collapse of EuropeÕs empires was transformed into the positive good
of "decolonization." (That decolonization hasn't exactly done good by, say,
Algerians or Sierra Leoneans, doesn't trouble the European conscience. What
matters is to hold to the belief that with the loss of power came a gain in
virtue.)

More basic to this equation, however, is the memory of the Holocaust. Typically
among Jews, the prevalence of anti-Zionism in Europe is ascribed to a latent
anti-Semitism, not to mention a desire to overcome a guilty conscience by
painting Israeli tactics as Nazi. This may be accurate in some instances, but I
would argue that the opposite is generally closer to the truth. Hatred of
Israel comes from too close an identification with the victims of the
Holocaust, with too great a fetish for powerlessness. Because Israel stands for
Jewish power, it was bound to lose favor to those who could present themselves
as the new victims. And Palestinians have been very adept at this.

What Europe wants, then, is not to harm Jews. It wants to save them, and
thereby avail itself of the only means of redeeming itself. But for that to
happen, Israel must again become as weak and vulnerable as it was before 1967.
Back then, recall, Israel was very popular among Europeans.

IT MAY SEEM strange that roughly the same people for whom consciousness of th


• Khaled Ibrahim Tapish szef Hamasu aresztowany! IP: *.cm-upc.chello.se
Gość: ;▄▄▄▄█ 19.04.02, 20:59 zarchiwizowany

13:00) Commandos capture Hamas military chief in Bethlehem



IDF commandos and reserve soldiers captured a commander of Hamas's military
wing in Bethlehem today.

Khaled Ibrahim Tapish was arrested along with another Hamas operative during
the course of IDF anti-terror operations in the West Bank city located just
south of Jerusalem.

The two Hamas men were handed over to the Shin Bet internal security agency for
interrogation, Army Radio reported.






• Najwiekszy terrorysta swiata :Marwan Barghouti IP: *.cm-upc.chello.se
Gość: ;▄▄▄▄█ 19.04.02, 01:09 zarchiwizowany

www.tzemach.org/fyi/docs/beres/april16-02.htm

The Trial of Marwan Barghouti
16 April 2002


When the victorious allied powers established a military tribunal at Nuremberg
on August 8, 1945, they reaffirmed an ancient principle of law: Nullum crimen
sine poena, "No crime without a punishment." In 1946, this reaffirmation was
codified as Principle I of the legally binding Nuremberg Principles: "Any
person who commits an act which constitutes a crime under international law is
responsible therefore and liable to punishment." These Nuremberg Principles,
later formulated by the United Nations International Law Commission in 1950,
stipulate: "Offenses against the peace and security of mankind...are crimes
under international law, for which all responsible individuals shall be
punished."
Terrorism is a serious offense against the "peace and security of mankind."
Marwan Barghouti, leader of Yassir Arafat's Fatah and the man openly
responsible for dozens of suicide bomb attacks on Israeli civilians, is one of
the world's most wanted terrorists. Arrested by Israeli special forces on April
15, 2002, during Prime Minister Sharon's essential retaliatory military
operations against Palestinian terrorist infrastructures, Barghouti will be put
on trial for his multiple crimes, including crimes against humanity. This
judicial action by Israel will represent indispensable support for our
decentralized system of international law, a system that always relies for its
success upon the willingness of individual states to use their own courts for
prosecution of international criminals.

Barghouti heads the Al Aqsa Martyrs Brigade, the Palestinian militia that plans
and celebrates the maiming, burning and murder of Jewish men, women and
children in schools, buses and restaurants. By the standards of contemporary
international law, terrorists are known as hostes humani generis, "common
enemies of humankind." In the fashion of pirates, who were to be hanged by the
first authorities into whose hands they fell, terrorists are international
outlaws who come within the scope of "universal jurisdiction." The fact that
Barghouti's terrible crimes had been directed specifically against Israel
removes any doubts about that country's particular jurisdiction in this matter.

Punishment of violent crime must always lie at the very heart of justice. In
our decentralized system of world law, which still lacks a permanently
functioning international criminal court, prosecution by individual states is
often the only available path to punishment. In the absence of Israel's
essential operations against Palestinian terrorism, outlaws like Barghouti
would remain altogether free to commit further atrocities. Immune to the proper
expectations of extradition and prosecution (the Palestinian Authority would
hardly agree to comply with these expectations of international law), Barghouti
would proceed with the organization of Palestinian children into cadres
of "martyrs." Barghouti naturally thinks of himself as a "freedom fighter," not
a terrorist. But even if his objective of Palestinian self-determination could
be accepted under authoritative international law (and this is highly
problematic), the means used in his use of violence are indisputably unlawful.
The Law of Armed Conflict, which applies to insurgents as well as to uniformed
armies, makes it clear that the ends can never justify the means. A cause, even
if legitimate, can never excuse the use of violence against the innocent.

International law is not a suicide pact. The State of Israel, in the fashion of
every state in world politics, has not only the right but the obligation to
protect its citizens' most basic human right — the right to remain alive. In
this connection, the Israeli military operation that led to Barghouti's arrest
is supported not only by the post-attack right of self-defense codified at
Article 51 of the UN Charter, but also by the customary right of anticipatory
self-defense.

Israel's actions in the Barghouti case are fully supported by the law of the
United States. For our own country, the Nuremberg obligations to bring
terrorists to trial are doubly binding. This is because these obligations
represent not only rules under international law, but also the obligations of a
Higher Law embedded in the American philosophic tradition. All international
criminal law is part of the law of the United States, an incorporation
expressed at Article VI of the US Constitution and by associated Supreme Court
decisions.

United States federal law confers jurisdiction "to try any person who, by the
laws of war, is subject to trial by a military tribunal...." (10 U.S.C. Sec.
818, 1994). Additionally, federal law grants jurisdiction to the federal
district courts for all offenses against the laws of the United States (18
U.S.C. Sec. 3231, 1994). Since the United States was founded, our country has
reserved the right to enforce international law within its own courts. At
Article 1, Sec. 8, Cl 10, the Constitution confers on Congress the power "to
define and punish piracies and felonies committed on the high seas, and
offenses against the law of nations."

Israel's planned prosecution of Palestinian terrorist Marwan Barghouti is fully
supported by both international law and the law of the United States of
America. Representing the best available option to support civilizational
remedies against barbarism, it is a jurisprudential effort that now warrants
worldwide support. It should also be recalled that Barghouti is a sworn enemy
of the United States, a criminal who aided Saddam Hussein in his rape of Kuwait
and who is closely allied with the medieval forces behind September 11th. On
September 12th, when Israeli flags were lowered to half staff, Barghouti
celebrated our national misfortune with other Fatah leaders.



--------------------------------------------------------------------------------



Louis Rene Beres (Ph.D., Princeton, 1971), Professor, Department of Political
Science, Purdue University, lectures and publishes widely on Israeli strategic
matters. His work is well-known to Israel's military and academic communities.
He is also the academic adviser at the Freeman Center for Strategic Studies, a
Houston-based research facility and political action group.



• jeszcze raz IP: *.cm-upc.chello.se
Gość: ▄▄▄: 18.04.02, 20:54 zarchiwizowany

Gość portalu: :▄▄▄▄: napisał(a):

> Gość portalu: :▄▄▄▄: napisał(a):
>
www.jewishhistory.huji.ac.il/
www.icj.huji.ac.il/
www.jewishhistory.huji.ac.il/links/Archaeology.htm
www.shamash.org/trb/judaism.html
>



• poprawka IP: *.cm-upc.chello.se
Gość: ▄▄▄: 18.04.02, 20:52 zarchiwizowany

Gość portalu: :▄▄▄▄: napisał(a):

www.jewishhistory.huji.ac.il/
www.icj.huji.ac.il/
www.jewishhistory.huji.ac.il/links/Archaeology.htm
www.shamash.org/trb/judaism.html



• Re: Linx______________________________________________ IP: *.cm-upc.chello.se
Gość: ▄▄▄: 18.04.02, 20:36 zarchiwizowany

jewishhistory.huji.ac.il/
icj.huji.ac.il/
jewishhistory.huji.ac.il/links/Archaeology.htm
shamash.org/trb/judaism.html


• Linx______________________________________________ IP: *.cm-upc.chello.se
Gość: 4;▄▄▄: 18.04.02, 19:55 zarchiwizowany


JTS ) Libraries & Museums ) Library of the Jewish Theological Seminary )
Recommended Links




About JTS
Academics
Administration
Applying to JTS
Campus Life
Directories
Libraries, Museums
Research
University without Walls

Homepage
Contact Us
Giving to JTS
Site Index
Site Map
Site Search


JTS Student Addresses Israel Solidarity Rally on 4/15/02
(4/17/02)

$4.5 Million Fellowship Fund for Education & Rabbinical Schools
(2/4/02)

New Rabbinical School recruitment site
(3/21/02)

2002 Summer Session information now online (1/14/02)

More JTS news

Ongoing Ivry Prozdor Alumni Outreach
3/17-8/2/02 Sonnets of Celebration at JTS Library
4/29/02 Is Liberalism Bad for the Jews?
5/8/02 Sex, Lies, and Much-Told Tales
6/24-7/12/02 3rd Intl. Advanced Seminar in Yiddish Studies

Recommended Links

Holocaust Resources Jewish Education


--------------------------------------------------------------------------------

Jewish Education
Table of Contents
Youth activities: movements, camps, Israel tour
Jewish day schools and supplementary schools
Net education
Distance education and home schooling
Resources for educators
BJE's
Journals
Databases
Organizations
Educational theory
Jewish communities around the world
Special education
Adult education
Virtual Education Libraries
Schools of Jewish Education


--------------------------------------------------------------------------------

YOUTH ACTIVITIES: MOVEMENTS, CAMPS, ISRAEL TOUR
North American Alliance for Jewish Youth
http://www.naajewishyouth.org/
National Ramah Commission
http://www.campramah.org/

Israel in our Lives
http://www.israelives.org/camp/camps.html
Full text (PDF) of Israel in Jewish Summer Camps by D. Friedman and D.
Zisenwine.
The site and organization are a joint project of JESNA: Jewish Education
Service of North America and Israel Experience, Inc.

Looksmart categories: Jewish summer camps
http://www.looksmart.com/eus1/eus53706/eus53720/eus145534/eus62482/eus917309/r?
l&
Links to websites of Jewish summer camps

Summercamps.com
http://www.summercamps.com/fs_search.html
Listing of contact information on summer camps; search for Jewish in Religion
category

LAJewishteen.org
http://www.lajewishteen.org/mainpage.htm
Israel tours sponsored by major Jewish and Zionist youth movements

Association of Jewish Youth
http://users.anjy.org/orgs/
Links to webpages of major Jewish and Zionist Youth Organizations. British
based non-profit Jewish community service.

World Zionist Organization - youth movement pages and links
http://www.wzo.org.il/politics/youthlinks.html



--------------------------------------------------------------------------------

JEWISH DAY SCHOOLS AND SUPPLEMENTARY SCHOOLS
Schechter Connector
http://www.uscj.org/ssds/index1.html
Centralized web site for Solomon Schechter schools
Ottawa Modern Jewish School
http://www.omjs.ca

The Rise of Jewish schools, by Peter Beinart
The Atlantic Monthly, October 1999
http://www.theatlantic.com/issues/99oct/9910jewishschools.htm

Jewish Secondary School #22 - Kishinev, Republic of Moldova
http://kishinev.lk.net/school.html

San Diego Orthodox Jewish Community and School Network
http://www.sandiegojewish.org/schools.html



--------------------------------------------------------------------------------

NET EDUCATION
Innovative Education Sites
http://faculty.washington.edu/~krumme/education.html
Links to websites on a wide variety of educational issues, including distance
learning, curriculum development, hypertext-hypermedia, etc.
Institute for Learning Technologies
http://www.ilt.columbia.edu/

Blue Web'n - a library of blue ribbon learning sites on the web
http://www.kn.pacbell.com/wired/bluewebn/

An Educator's Guide to the Internet
http://cac.psu.edu/~cgk4/design.html
Essay on and resources for the use of the Internet in secondary and college
courses.

Virtual Architecture's web home
http://ccwf.cc.utexas.edu/%7Ejbharris/Virtual-Architecture/
Electronic adaptation of Judy Harris' book Virtual Architecture, on the uses of
web education.

Educause
http://www.educause.edu/
Cutting edge articles on educational technology. Nonprofit association whose
mission is to help shape and enable transformational change in higher education
through the introduction, use, and management of information resources and
technologies in teaching, learning, scholarship, research, and institutional
management

Eduweb
http://www.eduweb.co.uk/index.html

Private Eye
http://www.the-private-eye.com/ruef/html/home.htm

AskEric lesson plans
http://www.askeric.org/Virtual/Lessons/

Busy Teachers' web site, K-12
http://www.ceismc.gatech.edu/busyt/toc.html

Thinkquest
http://www.thinkquest.org/library/



--------------------------------------------------------------------------------

DISTANCE EDUCATION AND HOME SCHOOLING
The Education Coalition
http://www.tecweb.org/eddevel/eddevframe.html
Essays and bibliographies on Distance Education. Non-profit educational
organization, created in 1993 to serve the needs of the business and education
communities.
Distance-Educator
http://www.distance-educator.com/
Commercial research and development consulting firm on all aspects of distance
learning.

Distance Learning on the Net
http://www.hoyle.com/distance.htm
Commercial consulting firm of Dr. Glenn Hoyle. Useful essays and links to K-12,
college and training distance learning web sites.

Pedia - the Hellenic educational web server
http://www.pedia.gr/links/lin-2-thmia.html
Secondary school links, including distance learning sites.

World Wide Web Virtual Library: Distance Education
http://www.cisnet.com/~cattales/Deducation.html
Comprehensive listing of links to sites containing offerings, journals,
organizations and essays relating to distance learning.

The Open Directory Project
http://dmoz.org/Reference/Education/Distance_Learning/Resources/Precollege/
Small selection of links to precollege distance learning resources.

Association for Supervision and Curriculum Development
http://www.ascd.org/readingroom.html
Association for Supervision and Curriculum Development archived journals,
including material on distance learning and much more

Wested - distance learning resource project
http://www.wested.org/tie/dlrn
Essays on distance learning. A non-profit research, development and service
agency dedicated to improving education and other opportunities for children,
youth and adults.

TEAMS distance learning
http://teams.lacoe.edu/welcome.html



--------------------------------------------------------------------------------

RESOURCES FOR EDUCATORS
University of Illinois - College of Education - resources
http://x.ed.uiuc.edu/EPS/Ed_Resources/index.html
McGill University - Jewish Studies program
http://www.arts.mcgill.ca/programs/Jewish/30yrs/education.html
J. Reimer et al on Jewish education

Jewish Education in Ancient Times, by R. Mosely
http://www.homeschoolfaq.com/jewish_education.htm
taken from online journal of Christian fans of Judaism

LTSI - Learning Thinking Styles Inventory
http://www1.vmi.edu/IR/ltsi.htm

Israel embassy in the United States)
Jewish education links
http://www.israelemb.org/miami/othedu.htm

Israeli education links
http://www.jr.co.il/hotsites/i-edu.htm

The Pedagogic Center - Jewish Agency for Israel
Department of Education
http://www.jajz-ed.org.il/index1.html

The Pedagogic Resource Centre for Jewish Education - Hebrew University
Center for Jewish Education in the Diaspora
http://sites.huji.ac.il/melton/library.html

Dissertations in Jewish Education
Hebrew University Center for Jewish Education in the Di


• TOPOLOGIA NONSENSU IP: *.cm-upc.chello.se
Gość: nonSens 18.04.02, 15:36 zarchiwizowany

Gość portalu: ® napisał(a):

)
) 2.6. Analytic Topologies
)
) Definition 2.6.1. A framed topology on A is called subnormal if for any object
)
) X and Ja, ważam za haniraboebne _aPRZYJAtwo_FaCNNcet z owskiej
strony brusem na glowie Glos somCzy ! CZY ZNAC KTszantazowanyDA MARK PFER OS
ZYBush nie jest ? any non-iWOTTCIOLrYLKOASOWE! JA-Okupklamie-klamie-** Rozmowa z
polGELATI_czzy _przezChrsadzz eścFEonI Żyych_Fratdz inkfur -
Polterror_jest_karaacy
ijanie #####
Apel Forum - ^^^^^_5_aw__bomby_i_terror_
___afmanbstwo_musi_wiedziec_Za__!!!!
oskarza Shra o barbaOriaKauaronna Frzynstwo Dzisiaj , wstydze sie , ze
jestem PoletlejWYosANIE_ISOaK eakiem AntyELSKpolski ??? laci ZIEGluRA
_TYMCZ_rozsaCOFgldkuacja bai w Bm Prozba
do ....Betlejabs..._________ZbeszBazyKoszmalice Narodzenia ARPańskieg AB
DOSZCZETNIE-
-
ARAArogancja kańskiej P !!!PAMIETAJMY__
"_na_ulicy_abhrzeras cijwsza aydokns sKrótka historia kiebo Polszanuje__
w eksplozję na !!DO_wszystkich_tych_co_
eatadzia-albo logika Czy jest konwencja, sla_ze_
IETY__!!!!!!!
CO ZROBILI POLŻFATA_KO? A_mialo_byc_tak_amknie__________ ubepieIslr alles
___w_szoku_!!!__terroyelcles tynza? • W_GA!!
_"RADOSCIZIE_CHOCIAZ LONCZY ZdiaZI URATIslDNEGamscy_maliOWALI YDÓWACY Fregi
IE_LETNIE_JAK_BYCrysci_styna_
którnie złamałIzrycya _SczaC AMJtan
j_rozdzielaja_cukOBOierki__!!!!!
ArlanaboYDHowie ael AJEO POLej IzrKA eza?_Zycze..
_____He_He_He_wTHE AV IER _"Zynaprawde was
lubie Riniedzi _Euow 8888zabitych_8888
ZMIANA NAZWY en 2,oposcic osiedla 06:58:35 Bale_-teorAl-Qaysci"_! _wiecej
_takich_zwycRDUJiestw mali$$$$$$ (1) 18-04-200Czy wiecie
ze tturmiecystja _rosna_mordujaow_niehrrid __z_wdzi erykcki cznosciABW : "Pa" is
a myth To dziwne , ale umslestinefeld: nam nie uciekł • $$$$$$$$ ZYGI MOA
PSopALEejcz
TYadeN BerCZYKOWlbin Ln
********__10_88888888888888888888888 Wsiadł do autobusu czowiek z...
ZyIslamiscidki musza i ... • przyglup administrator... •
STEcottydzcLLA • ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
:::::::: 4____4____4____4____4____4____4Koc, olgahanka, , Nie wstoyie sie,
Is A : I Shrink RzHewojydzi !!! B Fevsraelier Hits EuroBloody Characterpe
Zacz____4____ęłam się wahać czy poprzeCenzura w (Szokujace zdjecia)
!!! MARZE O SW BEZ r aw ARna ChawajeABOW ć Integroddac
JerZWYWyborczej CIEZY ozo_______________________________________________
ISR4____4____ AEL lime ZYCIEZDIEI MAJA MOgelatik,cMORDHorFałrienszywyalarmOWAC
RALNE
ację!!!!! • I zy c y e l z ! # - POPRAWIONE Zaginęli w
CzeczPRAWO enii o slychac CZY
Kolejseni ę ż tinsh ne nagranie bin Ladena Il sraeForces ected tinians into
SBooby-
Tr Pn Teager Tells Of rific Expece
JewiUaleiaKPaleKoleamacjny zhIsLErael - IZRATYNEL ress
Service statystyki skonfiskowana bron / arepoPAkojsusp MP: SStadziecięcej bombowy
w pociągu
PrzybWARlacz sieylricaice w Betm . szty / trupy • Ku
________________________________________________ SSHAI ARAFwojna RON AT-i
Dlaczego Zyndle dow? ________________________
wy do protestu w Washaron zyngtonie WYJAaronmud ZD ZA ining Jurejon bomSZAWY
osmutn) Definition 2.6.7. Suppose A is an analytic category.
) (a) A divisor is called subanalytic if it consists of analytic monos.
) (b) A framed (or metric) topology on A is called subanalytic if it is generated
)
) by a subanalytic divisor.
)
) Definition 2.6.8. (a) We say a framed topology is strict if the Grothendieck
) topology T() defined by open effective covers is subcanonical (i.e., any
) representable presheaf of sets is a sheaf) (see (2.5.7)).
) (b) An analytic category is called strict if its analytic topology is strict.
)
) In practice most of the natural framed topologies are subanalytic. The general
) rule is that if a natural analytic category is not strict (i.e. its analytic
) topology is not strict), then it carries another natural strict subanalytic
) framed topology which is more useful than the analytic topology.
)
) Example 2.6.8.1. (a) The analytic topologies of the categories of topological
) spaces, locales, or coherent spaces are not strict, yet each of these
) categories carries a natural strict subanalytic topology defined by the
) inclusion functor to the category of locales.
) (b) The analytic topologies of the categories of Hausdorff spaces, affine
) schemes, or Stone spaces are strict.
) If A is a coflat disjunctable analytic category
) (e.g. a topos) then any normal mono is analytic, thus the normal and analytic
) topologies are the y w Bie w-Amen obroniewirtualnejpornawdnonieuryśzimygrafii
Forces PTalShOlRAood • Tci w DARelfaścMO DO na manifestacje - zrodla informacji
______________KTOS_TO__COS!!!!!!!!!! UlejeSA Bazdaism With
BNAPWDE_TYLKproPAL SA ZWYY KA• Marsyjanie wyslali PUT • I z ę rwey
c i l z a ! 523ż y PRCIEZIME
Nigdy_nigdy_nigAYzeziIDO dziach DS AYIS ^^^Kzdy_kr
Demoja przeciw, wyjazd za _bronic_obywateliaj_musiOM
Mnstr acAJ) (b) All the metric topologies given in [Luo 1995a, Example
(RCZAZETżhA co jest eAPEL dziachUHKORKIEGO -
OD 88 _nie_bylo_takiego_tworu _przed_żydzlesti Informacje Brńs wypkiegoATKI?.
owiO) initial map t: ) map t: T --) X which is disjoint with U. This means in
particular that t is
) disjoint with an open effective cover of V. Thus (t): (T) --) (X) is disjoin
) t
) with v by (2.5.4.a).
) (b) Suppose is subnormal and u: U --) X is an open effective mono, then u
) generates an open effective sieve, which is normal by (a). Thus u is normal.
)
) We now show that a subnormal framed topology is completely determined by the
) subnormal divisor of open effective monos.
)
) Proposition 2.6.4. (a) Suppose D is a subnormal divisor on A. Then the functor
) D generated by D is a subnnadzieji z ZydoBazylika_!
Bl. Wscem hód: r w islamK ZGLUPIAL skim
francilakowszkaninem w
Dlaczego zydDżerzacjibiezi obrazaja Po? N chcą delegdyjczykówali Kościacj
onaliścimbarC zoła kcki • Zboterech Kana dował, bo nie wiedział ? Czy są
nieŻEBY ? Tragedia Ar_DZIECIafOr.. winni zginęło myzwycihandluja ckimi
niewoKOBRATOWAC ak zamieszany lnicami od amerymilosna ormal framed topology on
A. T --) X such that (t): (T) ® (X) is disjoint with v.
) Example 2.6.1.1. (a) The framed topologies discussed in (2.5.2.1) are
) subnormal.
agenścGcyjne..
Prośba Co jerest smutortne w dy_p• emm droga radiowa ESKMANAMMAD
sygnal w 1967 wynalazl kto Prydowskiczytaczam do panópowiepw ze StaroAWYBińskiej
tekst - co wy na to rzenigdyZepYDOWSniokojące wwyropaynskich NARODU
KIGCILWALEDY IMOSI ODDADZA ZaDdarmo do IrEX,TNIE aku I 6 LES

orphic open embedding v: V --) (X) of locales there is a n
) on-
2.2.1) - (2.2.3)]
) may be viewed naturally as subnormal framed topologies.
)
) Proposition 2.6.2. A framed topology is subnormal iff any unipotent cover
) consisting of open effective subobjects is an open effective cover.
)
) Proof. First suppose is subnormal. Given a unipotent cover {ui: Ui --) X}
) consisting of open effective monos. Let v: V --) (X) be the join of {(Ui)}.
) We
) have to prove that {ui: Ui --) X} is an open effective cover, i.e. V = (X).
) We
) prove it by contradiction. Assume that V is a proper sublocale of (X). Then by
) (2.6.1) there is a non-initial map t: T --) X such that (t): (T) --) (X)
) is
) disjoint with v. Then t is disjoint with each ui by (2.5.4.a). But this is
) impossible as by assumption {ui} is a unipotent cover. Thus V = (X), i.e. {ui}
) is an open effective cover on X.
) Conversely, assume the condition is satisfied. Suppose v: V --) (X) is a non
) -
) isomorphic open embedding of locales, which is a join of open effective
) sublocales (vi): (Vi) --) (X) by (2.5.2.b). Then {vi} is not unipotent by
) assumption. So we can find a non-initial map t: T --) X which is disjoint wi
) th


• ________________________________________________ IP: *.cm-upc.chello.se
Gość: gif 18.04.02, 02:44 zarchiwizowany

www.jabotinsky.org/ani.gif


• TOPOLOGIA IP: *.cm-upc.chello.se
Gość: ® 17.04.02, 20:17 zarchiwizowany


2.6. Analytic Topologies

Definition 2.6.1. A framed topology on A is called subnormal if for any object
X and any non-isomorphic open embedding v: V --> (X) of locales there is a non-
initial map t: T --> X such that (t): (T) ® (X) is disjoint with v.
Example 2.6.1.1. (a) The framed topologies discussed in (2.5.2.1) are
subnormal.
(b) All the metric topologies given in [Luo 1995a, Example (2.2.1) - (2.2.3)]
may be viewed naturally as subnormal framed topologies.

Proposition 2.6.2. A framed topology is subnormal iff any unipotent cover
consisting of open effective subobjects is an open effective cover.

Proof. First suppose is subnormal. Given a unipotent cover {ui: Ui --> X}
consisting of open effective monos. Let v: V --> (X) be the join of {(Ui)}. We
have to prove that {ui: Ui --> X} is an open effective cover, i.e. V = (X). We
prove it by contradiction. Assume that V is a proper sublocale of (X). Then by
(2.6.1) there is a non-initial map t: T --> X such that (t): (T) --> (X) is
disjoint with v. Then t is disjoint with each ui by (2.5.4.a). But this is
impossible as by assumption {ui} is a unipotent cover. Thus V = (X), i.e. {ui}
is an open effective cover on X.
Conversely, assume the condition is satisfied. Suppose v: V --> (X) is a non-
isomorphic open embedding of locales, which is a join of open effective
sublocales (vi): (Vi) --> (X) by (2.5.2.b). Then {vi} is not unipotent by
assumption. So we can find a non-initial map t: T --> X which is disjoint with
each vi. By (2.5.4.a) (t) is disjoint with the join v of (vi). This shows that
is subnormal by definition (2.6.1).

Proposition 2.6.3. (a) A framed topology is subnormal iff every open sieve is
normal.
(b) The open divisor D() of a subnormal framed topology is subnormal.

Proof. (a) First suppose is subnormal. Consider an open sieve U on an object
X, which is the pullback of an open embedding v: V --> (X) of locales (i.e., a
map s is in U iff (s) factors through v). To see that U is normal we have to
prove that if t: T --> X is a map dominated by U, then t is in U, i.e. (t)
factors through v. Assume that this is not the case. Then (t)-1(V) is a proper
open sublocale of (T). Since is normal we can find a non-initial map s: S -->
T such that (s) is disjoint with (t)-1(V). Thus (t°s) is disjoint with V. Hence
ts is disjoint with U. But this contradicts the fact that t is dominated by U.
This shows that U is normal.
Conversely assume that any open sieve is normal. Suppose v: V --> (X) is a non-
isomorphic open embedding of locales. The open sieve U determined by V is a
proper normal sieve on X. Thus U is not unipotent. So we can find a non-initial
map t: T --> X which is disjoint with U. This means in particular that t is
disjoint with an open effective cover of V. Thus (t): (T) --> (X) is disjoint
with v by (2.5.4.a).
(b) Suppose is subnormal and u: U --> X is an open effective mono, then u
generates an open effective sieve, which is normal by (a). Thus u is normal.

We now show that a subnormal framed topology is completely determined by the
subnormal divisor of open effective monos.

Proposition 2.6.4. (a) Suppose D is a subnormal divisor on A. Then the functor
D generated by D is a subnormal framed topology on A.
(b) A subnormal framed topology is equivalent to the subnormal framed topology
D().

Proof. (a) We already know from (2.4.2) that D is a functor from A to the
category of locales and (X) = 0 iff X is initial; each D-sieve on X may be
viewed naturally as an open sublocale of (X). Since any D-mono u: U --> X is
normal, a map t: T --> X factors through u iff it is dominated by u, and the
later is equivalent to that (t) factors through (u). Also one can show easily
that (u): (U) --> (X) is an open embedding of locales. Hence u and (u) is open
effective for . By (2.4.1) any D-sieve is generated by a set of D-monos U =
{ui: Ui --> X}, thus any open sublocale of (X) is a join of open effective
sublocales. This shows that is a framed topology, which is subnormal by
(2.6.3.a).
(b) Suppose is a subnormal framed topology. The open divisor D() of is
subnormal by (2.6.3.b), and open sieves coincide with D()-sieves. We obtain a
mapping from (X) to D()(X), which is a natural isomorphism.

Corollary 2.6.5. (a) A subnormal framed topology is spatial iff for any non-
initial object X the locale (X) has a point.
(b) If A is locally atomic then any subnormal framed topology on A is spatial.

Proof. These follow from (2.4.6) in view of (2.6.4).

Definition 2.6.6. (a) If A has pullbacks the framed topology N generated by the
normal divisor N of normal monos is called the normal topology.
(b) If A is an extensive category the framed topology E generated by the
extensive divisor E of direct monos is called the extensive topology.
(c) If A is an analytic category the framed topology A generated by the
analytic divisor A of analytic monos is called the analytic topology.

Clearly the normal topology is the finest subnormal framed topology on a
category A with pullbacks. If A is a coflat disjunctable analytic category
(e.g. a topos) then any normal mono is analytic, thus the normal and analytic
topologies are the same in this case. On the other hand, if A is an analytic
category in which any strong mono is an intersection of direct monos (e.g. the
category of Stone spaces), then analytic category reduces to extensive
topology. Some special cases of extensive topologies have been studied by
several authors (see, for instance, Barr and Pare [1980] and Diers [1986]). We
will study the main properties of these canonical topologies in Chapter 3.

Definition 2.6.7. Suppose A is an analytic category.
(a) A divisor is called subanalytic if it consists of analytic monos.
(b) A framed (or metric) topology on A is called subanalytic if it is generated
by a subanalytic divisor.

Definition 2.6.8. (a) We say a framed topology is strict if the Grothendieck
topology T() defined by open effective covers is subcanonical (i.e., any
representable presheaf of sets is a sheaf) (see (2.5.7)).
(b) An analytic category is called strict if its analytic topology is strict.

In practice most of the natural framed topologies are subanalytic. The general
rule is that if a natural analytic category is not strict (i.e. its analytic
topology is not strict), then it carries another natural strict subanalytic
framed topology which is more useful than the analytic topology.

Example 2.6.8.1. (a) The analytic topologies of the categories of topological
spaces, locales, or coherent spaces are not strict, yet each of these
categories carries a natural strict subanalytic topology defined by the
inclusion functor to the category of locales.
(b) The analytic topologies of the categories of Hausdorff spaces, affine
schemes, or Stone spaces are strict.




• LICZBA PIERWSZA noText IP: *.cm-upc.chello.se
Gość: 101 17.04.02, 02:58 zarchiwizowany



• _____________NY_______________
alef1 17.04.02, 01:08 zarchiwizowany

www.earthcam.com/usa/newyork/timessquare/


• ______O___R____I____E___N___T______
alef1 17.04.02, 00:13 zarchiwizowany

www.1000and1.de/
www.1000and1.de/forum/index_e.htm
www.1000and1.de/picture/jpg/matahar.jpg
www.1000and1.de/picture/portrait/eshtar2.jpg
www.1000and1.de/picture/portrait/zeynep2.jpg
www.1000and1.de/forum/index_e.htm
************************
Lydia Tzigane

Click on Picture for more! Lydia Tzigane lives in Sharjah, a city in the United
Arabic Emirates and performs mostly in Dubai.
Since 1984 she has espoused the oriental dance and has shown her knowledge of
art
already in many of the large hotels of the middle east.
A long time she has a dream, to become a dancer, if she has thought also
initially sooner about a career in the ballet. Then however she got to know the
oriental culture and and she love it. So she began to learn the oriental dance.
The feeling for this dance has gotten put Lydia well about her Origin, she is
an
Romanov Gipsy.
She began her dance-career in Egypt and the persons there pleased here
dancestyle
and work so well, that she was booked more and more for appearances, and from
there she got more and more bookings and contracts.
There followed firm engagements in many important hotels of the middle east.
Lydia Tzigane has found her own style.

She says over herself:
"I love it because it is a free form of dancing ,there are some rules and
basics ,but every dancer can put her own soul and fire in it,to make it special
for her and her liking,that is why i like it you can grow and learn every day
in
this dancing,put more wood on the fire and the flames becomes bigger. It never
stops, it is a beautiful artform, and fills your soul."
"Tahaya Karyoka,told me when i met her in Egypt,to stay as i was ,not to copy
any
other dancer and to became my own identety, so people would remember me,with my
own style,that is what i never forgot,and it worked!! people always tell me --
you
are different-- It was a good advice."

Contact :
Lydia Tzigane
25920 Sharjah
Zaroonistreet 14
United Arabic Emirates
Phone : 971.6.7660297

www.lydiatzigane.com




• _________¨¨¨¨¨¨¨¨_________________________________ IP: *.cm-upc.chello.se
Gość: _¨¨¨¨¨¨_ 16.04.02, 20:33 zarchiwizowany

σμα ισραελ
αδοναι ελοηεινθ αδοναξ
εηαδ


• SHALOM ELOHIM IP: *.cm-upc.chello.se
Gość: #1082;А 15.04.02, 03:51 zarchiwizowany

was macht a Jidd?
iz redst man iddsh...
com.id
F

אAα
Tρן
'цW
ZEN
ζקn
koan
лщфт
לםשמ

...................
koлשф
מщ
לם

..
.
.
.
.
.



тan



• &# 932;&# 917;&# 931;&# 932;
alef1 15.04.02, 03:23 zarchiwizowany

אקדא
ЕУЫЕ
____________

ΤУΤא
ЕדЕא
ΣקΕЫ


• SIERPIEN IP: *.cm-upc.chello.se
Gość: 1995 14.04.02, 22:03 zarchiwizowany

4

04-09-1995

tajemnica?

?אשחקצמןבש


• LOST MEMORIES IP: *.cm-upc.chello.se
Gość: 1994 14.04.02, 21:17 zarchiwizowany

1993
1997
1999


• Re: 73 IP: *.cm-upc.chello.se
Gość: 93 14.04.02, 19:50 zarchiwizowany

zupagrzybowa napisał(a):

> Liczba pierwsza , ciekawa...

חש אשקז חקדאקצ
ךןבזנש פןקר'דזש
פםזגרש'ןש גרכ


• ALE NUMERY !!!!!!!!!!!!!!!!!!!!!!!!!!!!!! IP: *.cm-upc.chello.se
Gość: #1512;ןצק 14.04.02, 19:22 zarchiwizowany

3
5
7
11
13
17
19
23
29
31
37
41
43
47
53
59
61
67
71
73
79
83
89
97
101
103
107
109
113
127
131
137
139
149
151
157
163
167
173
179
181
191
193
197
199
211
223
227
229
233
239
241
251
257
263
269
271
277
281
283
293
307
311
313
317
331
337
347
349
353
359
367
373
379
383
389
397
401
409
419
421
431
433
439
443
449
457
461
463
467
479
487
491
499
503
509
521
523
541
547
557
563
569
571
577
587
593
599
601
607
613
617
619
631
641
643
647
653
659
661
673
677
683
691
701
709
719
727
733
739
743
751
757
761
769
773
787
797
809
811
821
823
827
829
839
853
857
859
863
877
881
883
887
907
911
919
929
937
941
947
953
967
971
977
983
991
997
1009
1013
1019
1021
1031
1033
1039
1049
1051
1061
1063
1069
1087
1091
1093
1097
1103
1109
1117
1123
1129
1151
1153
1163
1171
1181
1187
1193
1201
1213
1217
1223
1229
1231
1237
1249
1259
1277
1279
1283
1289
1291
1297
1301
1303
1307
1319
1321
1327
1361
1367
1373
1381
1399
1409
1423
1427
1429
1433
1439
1447
1451
1453
1459
1471
1481
1483
1487
1489
1493
1499
1511
1523
1531
1543
1549
1553
1559
1567
1571
1579
1583
1597
1601
1607
1609
1613
1619
1621
1627
1637
1657
1663
1667
1669
1693
1697
1699
1709
1721
1723
1733
1741
1747
1753
1759
1777
1783
1787
1789
1801
1811
1823
1831
1847
1861
1867
1871
1873
1877
1879
1889
1901
1907
1913
1931
1933
1949
1951
1973
1979
1987
1993
1997
1999
2003
2011
2017
2027
2029
2039
2053
2063
2069
2081
2083
2087
2089
2099
2111
2113
2129
2131
2137
2141
2143
2153
2161
2179
2203
2207
2213
2221
2237
2239
2243
2251
2267
2269
2273
2281
2287
2293
2297
2309
2311
2333
2339
2341
2347
2351
2357
2371
2377
2381
2383
2389
2393
2399
2411
2417
2423
2437
2441
2447
2459
2467
2473
2477
2503
2521
2531
2539
2543
2549
2551
2557
2579
2591
2593
2609
2617
2621
2633
2647
2657
2659
2663
2671
2677
2683
2687
2689
2693
2699
2707
2711
2713
2719
2729
2731
2741
2749
2753
2767
2777
2789
2791
2797
2801
2803
2819
2833
2837
2843
2851
2857
2861
2879
2887
2897
2903
2909
2917
2927
2939
2953
2957
2963
2969
2971
2999
3001
3011
3019
3023
3037
3041
3049
3061
3067
3079
3083
3089
3109
3119
3121
3137
3163
3167
3169
3181
3187
3191
3203
3209
3217
3221
3229
3251
3253
3257
3259
3271
3299
3301
3307
3313
3319
3323
3329
3331
3343
3347
3359
3361
3371
3373
3389
3391
3407
3413
3433
3449
3457
3461
3463
3467
3469
3491
3499
3511
3517
3527
3529
3533
3539
3541
3547
3557
3559
3571
3581
3583
3593
3607
3613
3617
3623
3631
3637
3643
3659
3671
3673
3677
3691
3697
3701
3709
3719
3727
3733
3739
3761
3767
3769
3779
3793
3797
3803
3821
3823
3833
3847
3851
3853
3863
3877
3881
3889
3907
3911
3917
3919
3923
3929
3931
3943
3947
3967
3989
4001
4003
4007
4013
4019
4021
4027
4049
4051
4057
4073
4079
4091
4093
4099
4111
4127
4129
4133
4139
4153
4157
4159
4177
4201
4211
4217
4219
4229
4231
4241
4243
4253
4259
4261
4271
4273
4283
4289
4297
4327
4337
4339
4349
4357
4363
4373
4391
4397
4409
4421
4423
4441
4447
4451
4457
4463
4481
4483
4493
4507
4513
4517
4519
4523
4547
4549
4561
4567
4583
4591
4597
4603
4621
4637
4639
4643
4649
4651
4657
4663
4673
4679
4691
4703
4721
4723
4729
4733
4751
4759
4783
4787
4789
4793
4799
4801
4813
4817
4831
4861
4871
4877
4889
4903
4909
4919
4931
4933
4937
4943
4951
4957
4967
4969
4973
4987
4993
4999
5003
5009
5011
5021
5023
5039
5051
5059
5077
5081
5087
5099
5101
5107
5113
5119
5147
5153
5167
5171
5179
5189
5197
5209
5227
5231
5233
5237
5261
5273
5279
5281
5297
5303
5309
5323
5333
5347
5351
5381
5387
5393
5399
5407
5413
5417
5419
5431
5437
5441
5443
5449
5471
5477
5479
5483
5501
5503
5507
5519
5521
5527
5531
5557
5563
5569
5573
5581
5591
5623
5639
5641
5647
5651
5653
5657
5659
5669
5683
5689
5693
5701
5711
5717
5737
5741
5743
5749
5779
5783
5791
5801
5807
5813
5821
5827
5839
5843
5849
5851
5857
5861
5867
5869
5879
5881
5897
5903
5923
5927
5939
5953
5981
5987
6007
6011
6029
6037
6043
6047
6053
6067
6073
6079
6089
6091
6101
6113
6121
6131
6133
6143
6151
6163
6173
6197
6199
6203
6211
6217
6221
6229
6247
6257
6263
6269
6271
6277
6287
6299
6301
6311
6317
6323
6329
6337
6343
6353
6359
6361
6367
6373
6379
6389
6397
6421
6427
6449
6451
6469
6473
6481
6491
6521
6529
6547
6551
6553
6563
6569
6571
6577
6581
6599
6607
6619
6637
6653
6659
6661
6673
6679
6689
6691
6701
6703
6709
6719
6733
6737
6761
6763
6779
6781
6791
6793
6803
6823
6827
6829
6833
6841
6857
6863
6869
6871
6883
6899
6907
6911
6917
6947
6949
6959
6961
6967
6971
6977
6983
6991
6997
7001
7013
7019
7027
7039
7043
7057
7069
7079
7103
7109
7121
7127
7129
7151
7159
7177
7187
7193
7207
7211
7213
7219
7229
7237
7243
7247
7253
7283
7297
7307
7309
7321
7331
7333
7349
7351
7369
7393
7411
7417
7433
7451
7457
7459
7477
7481
7487
7489
7499
7507
7517
7523
7529
7537
7541
7547
7549
7559
7561
7573
7577
7583
7589
7591
7603
7607
7621
7639
7643
7649
7669
7673
7681
7687
7691
7699
7703
7717
7723
7727
7741
7753
7757
7759
7789
7793
7817
7823
7829
7841
7853
7867
7873
7877
7879
7883
7901
7907
7919
7927
7933
7937
7949
7951
7963
7993
8009
8011
8017
8039
8053
8059
8069
8081
8087
8089
8093
8101
8111
8117
8123
8147
8161
8167
8171
8179
8191
8209
8219
8221
8231
8233
8237
8243
8263
8269
8273
8287
8291
8293
8297
8311
8317
8329
8353
8363
8369
8377
8387
8389
8419
8423
8429
8431
8443
8447
8461
8467
8501
8513
8521
8527
8537
8539
8543
8563
8573
8581
8597
8599
8609
8623
8627
8629
8641
8647
8663
8669
8677
8681
8689
8693
8699
8707
8713
8719
8731
8737
8741
8747
8753
8761
8779
8783
8803
8807
8819
8821
8831
8837
8839
8849
8861
8863
8867
8887
8893
8923
8929
8933
8941
8951
8963
8969
8971
8999
9001
9007
9011
9013
9029
9041
9043
9049
9059
9067
9091
9103
9109
9127
9133
9137
9151
9157
9161
9173
9181
9187
9199
9203
9209
9221
9227
9239
9241
9257
9277
9281
9283
9293
9311
9319
9323
9337
9341
9343
9349
9371
9377
9391
9397
9403
9413
9419
9421
9431
9433
9437
9439
9461
9463
9467
9473
9479
9491
9497
9511
9521
9533
9539
9547
9551
9587
9601
9613
9619
9623
9629
9631
9643
9649
9661
9677
9679
9689
9697
9719
9721
9733
9739
9743
9749
9767
9769
9781
9787
9791
9803
9811
9817
9829
9833
9839
9851
9857
9859
9871
9883
9887
9901
9907
9923
9929
9931
9941
9949
9967
9973
10007
10009
10037
10039
10061
10067
10069
10079
10091
10093
10099
10103
10111
10133
10139
10141
10151
10159
10163
10169
10177
10181
10193
10211
10223
10243
10247
10253
10259
10267
10271
10273
10289
10301
10303
10313
10321
10331
10333
10337
10343
10357
10369
10391
10399
10427
10429
10433
10453
10457
10459
10463
10477
10487
10499
10501
10513
10529
10531
10559
10567
10589
10597
10601
10607
10613
10627
10631
10639
10651
10657
10663
10667
10687
10691
10709
10711
10723
10729
10733
10739
10753
10771
10781
10789
10799
10831
10837
10847
10853
10859
10861
10867
10883
10889
10891
10903
10909
10937
10939
10949
10957
10973
10979
10987
10993
11003
11027
11047
11057
11059
11069
11071
11083
11087
11093
11113
11117


• WAKACJE Z MISIEM IP: *.cm-upc.chello.se
Gość: SE 14.04.02, 04:50 zarchiwizowany

www.tango.dk/misio/


• Beyond a reasonable doubt 2 IP: *.cm-upc.chello.se
Gość: NY 13.04.02, 16:36 zarchiwizowany


Arafat, throughout his long career as a master terrorist, has
cultivated "plausible deniability" into an art form. In the 1970s, attacks were
carried out by PLO factions in their own name, (Black September, the PFLP, the
DFLP, the PFLP Central Command, and so on). This state of affairs allowed
Arafat to simultaneously command terrorist operations and feign innocence,
touting himself as a "political leader" much as he does today.

The hard evidence of Arafat's direct command over all aspects of the
Palestinian terrorist war against Israel provided by the documents seized by
the IDF since the onset of Operation Defensive Shield, together with the
indirect evidence provided by intelligence reports, his harboring of wanted
terrorists in Ramallah (aside from Shubaki, Arafat is also hosting the
murderers of tourism minister Rehavam Ze'evi), the presence of illicit weapons-
making workshops in his command posts, and the fact that all Palestinian
terrorists name him as their supreme commander, render his deniability
implausible.

It could easily be argued the documentary evidence alone provides a more
convincing case of Arafat's direct responsibility for terrorism than the US
government has presented regarding Osama bin Laden's responsibility for the
September 11 attacks. Israel has proven Arafat pays terrorists. The US has not
shown direct proof bin Laden personally oversees payments to Al-Qaida
terrorists.

In 1989, the Palestinian National Council, the PLO's legislative arm, purported
to become a party to the Geneva Conventions. Article 146 of the Fourth Geneva
Convention stipulates, "Each high contracting party shall be under the
obligation to search for persons alleged to have committed or to have ordered
to be committed such grave breaches and shall bring such persons, regardless of
their nationality before its own courts." Among the "grave breaches" listed is
murder.

Powell has repeatedly and emphatically stated his position that Arafat is a
legitimate leader and the road to peace goes through him. Given the evidence
here presented, and additional findings that have been streaming in since
interrogations of Palestinian prisoners began in earnest this week, perhaps the
time has come for him to rethink this position.

www.jpost.com/Editions/2002/04/12/News/News.46842.html


• Beyond a reasonable doubt IP: *.cm-upc.chello.se
Gość: NY 13.04.02, 16:33 zarchiwizowany

Beyond a reasonable doubt


--------------------------------------------------------------------------------
Column One By Caroline Glick April, 12 2002

--------------------------------------------------------------------------------


(April 12) - In his address to the Knesset earlier this week, Prime Minister
Ariel Sharon laid the groundwork for a possible indictment of Palestinian
Authority Chairman Yasser Arafat for war crimes. Let's review the evidence to
help US Secretary of State Colin Powell prepare for his meeting with Arafat
tomorrow.

Sharon read from two documents confiscated from Arafat's headquarters in
Ramallah during IDF operations. The first document, dated January 7, 2002, is a
request from Raed Karmi, then head of Fatah-Tanzim in the Tulkarm area,
addressed to his chief, Marwan Barghouti, asking for financial assistance for
12 Fatah terrorists serving under his command. Barghouti forwarded the letter
to Arafat, with a note, "I request of you to order the allocation of $1,000 for
each of the fighter brethren."

At the bottom of the document is a handwritten note signed by Arafat, "Please
allocate $350 to each."

The second document, dated September 19, 2001, is a letter to Arafat from
senior Fatah leader in the West Bank Hussein al-Sheikh requesting Karmi, Ziad
Muhammad Daas, and Amar Qadan receive payments of $2,500 apiece.

Daas is the commander of the Fatah-Tanzim cell which carried out the massacre
at Nina Kardashov's bat mitzva party in Hadera this past January, and Amar
Qadan is a senior terrorist operative from Force 17 in Ramallah.

At the bottom of the document is a note in Arafat's handwriting over his
signature to "Treasury/Ramallah" with the instruction to "allocate $600 to each
of them."

A third document confiscated by the IDF, which Sharon refrained from
mentioning, is an undated status report regarding Fatah terrorist cells in
Tulkarm, and it is nothing less than devastating to anyone wishing to claim the
Palestinian Authority is anything other than a terrorist organization.

The document is addressed to Tawfik Tirawi, commander of the General
Intelligence Service in the northern West Bank, and written by Hamdi al-
Darduch, its Tulkarm district commander.

Praising Ziad Daas and his men, Darduch writes, "This squad has carried out
high quality, successful attacks. Their latest operation was the coordination
and planning of the operation in Hadera. [That is, the murder of six Israelis
at the bat mitzva party.] This squad is the most disciplined, and its men...
are very close to us and are continuously coordinated and in contact with us."

At the outset of the document, Darduch explained that three of the M-16 rifles
possessed by Fatah-Tanzim gunmen in his district were financed by Tanzim "as
well as through donations and financial assistance from the Honorable President
[Arafat]." Toward the end of his report, Darduch, bemoans the rivalries among
the various terrorist cells and between them and the General Intelligence
Directorate, complaining that all the infighting is taking place "at the time
when we've finally reached the understanding that Fatah gunmen constitute,
first and foremost, a support and auxiliary force for the PA and its security
apparatuses."

Darduch, however, takes heart in the fact that "among the Fatah gunmen are
brothers who are prominent in their activities, steadfast in their loyalty to
the Fatah and in their understanding of the political situation and what is
demanded at every one of the political stages." Their activities, he says, are
funded by the Tanzim Secretariat in Tulkarm as well as by the "emergency
budget" which, the IDF explains, is "apparently the funds transferred by the PA
leadership through the 'Emergency Committee' chaired by Hakam Balawi."

In his recommendations to his commander, Darduch writes, "We have to get rid of
a number of parasites who have penetrated the ranks of the gunmen but have not
shot one bullet at the Israelis."

These three documents constitute direct and indirect evidence of Arafat's
command and control over Palestinian terrorism. His signed notes unequivocally
implicate him as the direct commander of major terrorist operatives who have
planned and coordinated attacks against scores of Israelis. He decides who will
get paid and how much.

Darduch's report proves there is no difference between the PA and terrorist
cells. Arafat finances weapons procurement down to the individual rifle, and
his security apparatuses fund, coordinate, participate in, and oversee the
activities of the terrorist cells.

Apologists for Arafat would argue that since the sums he allocated to the
various terrorist leaders in the seized documents are small, it cannot possibly
follow that he is in charge of them. However, a more likely explanation is that
Arafat holds absolute control over everything that happens in the PA, down to
the last rifle and penny.

This latter explanation was reached in another context by the US Council on
Foreign Relations in June 1999. At that time, the council published a report on
the state of the PA, commissioned by the EU. In its report, authored by Henry
Siegman and Terje Larsen (two well-known advocates of Yasser Arafat), the
council found Arafat concentrates decision-making authority in his own hands to
the point where "he personally approves all senior officials' vacations and per
diem expenses."

Against this backdrop, Arafat's contention to US President George W. Bush,
which was wistfully echoed for a time by the US State Department and the EU,
that he did not know about the $500,000 spent on the purchase of the Karine A
weapons ship - or the $10 million paid to Iran for its cargo of missiles,
missile launchers, C4 explosive, mines, mortars, hand grenades, machine guns,
and ammunition - becomes patently ridiculous. The contention that Arafat does
not control the terrorists is also rendered unsupportable.

To the documented proof of Arafat's direct command over the Fatah-Tanzim
terrorist infrastructure must be added his collusion with Islamic Jihad and
Hamas. At the outset of the Palestinian terrorist war, Arafat's underling
Barghouti formed the "Unified Command of the Intifada," which coordinates
attacks with Islamic Jihad and Hamas. The fact the PA itself is part and parcel
of the Palestinian terrorist infrastructure was further brought home when the
IDF discovered weapons-making workshops inside the Palestinian Security
Service's compound in Yatta.

Arafat's operations are not limited to the West Bank and Gaza Strip, but
involve at least two members of Bush's "axis of evil." Last week, the Sunday
Telegraph reported Western intelligence sources claim an Arafat aide met last
month with Iraqi intelligence officials and provided them with a list of
strategic targets inside Israel and Saudi Arabia. The sources also said
Arafat's aide provided Iraqi intelligence with 37 forged passports.

On the subject of forgeries, in their raid of Arafat's headquarters, soldiers
uncovered huge sums of counterfeit US dollars and shekels. Arafat is holed up
in his compound with Fuad Shubaki, who financed the Karine A operation as he
does all of the PA's weapons procurements. Shubaki and Fathi al-Razem, deputy
commander of the Palestinian Naval Police, have been, according to American and
Israeli intelligence officials, Arafat's point men in developing close ties
with the Iranian regime since last May. Perhaps Arafat gained counterfeiting
expertise through his close connections with the Iranian government - which had
produced such sophisticated forgeries of the dollar and shekel in the mid-1990s
that both countries were forced to design and issue new bills.

Arafat, throughout his long career as a master terrorist, has
culti


• Re: samobojczyTerror 3 IP: *.cm-upc.chello.se
Gość: d 12.04.02, 00:28 zarchiwizowany

Muhammad an-Nasir, who was to drive a rigged car to a southern Lebanese sentry
station in September 1985, was the most obviously unwilling suicide. He acted
in so untrustworthy a fashion that a car followed him to make sure he followed
orders. But just before reaching the designated checkpoint, Nasir left his
vehicle to try to convince the driver of the second car to exchange places with
him. The latter refused; and while the two were engaged in argument, both were
arrested.

Others retained hopes of escaping alive. One assailant was told to drive his
bomb-laden truck against a specific part of the U.S. embassy and then escape to
an accomplice's car before the explosion went off. Another was assured that a
flak jacket and a special plating around the driver's seat gave him a 50
percent chance of surviving the explosion. In one case, it appears that the
suitcase a young girl was carrying to a checkpoint was exploded by a man at
some distance away. Some cars are rigged to explode if the suicide driver turns
the engine off or opens a door.

Children can be induced to suicide more easily than adults, by promising them
untold glories. Here is an account in Newsweek about the fate of a Palestinian
youngster:

Heavenly pleasures awaited Moussa Ziyada: rivers of sweet honey and holy wine,
72 virgin brides and free passes to Paradise for 70 of his friends and
relatives. For a boy who had never left the Gaza Strip, where the only rivers
are streams of sewage, the promise was dazzling. "All that eyes have not seen
and ears have not heard," as he puts it, were soon to be his. At age 14, he
would be venerated as a martyr and a hero. All he had to do was blow himself up
in a crowd of Israelis.
In the words of the boy's suicide trainer: "Now you are great, you are holy,
you are ready to go to heaven."

These are not the hallmarks of "fanatics," but of individuals dragooned into
service. Analysts who see the suicide attackers as volunteers miss the point:
anyone unfortunate enough to get into a traffic collision can find himself days
later driving a bomb-laden car. Inmates on death row, political dissidents,
members of ethnic minorities-under the proper conditions, any of these can be
coerced to undertake a suicidal attack.

State involvement broadens the pool of potential assassins. States cannot
depend on finding individuals prepared to discard their lives, for these are
far too few to be relied upon for regular operations. If only extremists could
be recruited for suicide missions, these would have limited potential; but
bringing in vulnerable persons from the general public means that anyone might
end up a suicide attacker. The resources of the state are more than ample to
produce a steady supply of non-fanatical suicide bombers. What has hitherto
required a special fervor has become routinized and institutionalized.

This analysis has two major implications. First, because suicide missions have
no necessary connection to Islam, they can be employed by brutal regimes of any
ideological stripe. The Syrian regime has best demonstrated its versatility. Of
the 15 suicide attacks it sponsored against Israel in 1985, 6 belonged to the
Ba'th Party, a secularist pan-Arab organization; 5 belonged to the Syrian
Social Nationalist Party, espousing secularist pan-Syrianism; 2 belonged to
Amal, the Shi'i organization aligned with Syria; and one each belonged to the
Communist party and to an Egyptian opposition group. One of the suicides was a
Druze, 4 were Shi'is, and 10 Sunnis. At least 2 were Syrian nationals and 2
Egyptian, the rest coming from Lebanon.

Suicide bombing has already spread throughout the Middle East; it could be
adopted in other regions too as other governments do as Damascus and imitate
Iran's tactics. Although the Soviet Union appears not to have adopted them yet,
it may well do so; why ignore a weapon of such potency? The same goes for other
totalitarian and authoritarian states. Suicide bombings may prove to be the
great and enduring monument of the Khomeini regime.

Second, the involvement of states points to the proper response of the United
States and its allies. It is futile to mount a defense by concentrating on the
terrorist actor himself; even if one falls, he can be easily and quickly
replaced with another. The way to combat the scourge of suicide terrorism is by
punishing the states that sponsor this violence.


• Re: samobojczyTerror 2 IP: *.cm-upc.chello.se
Gość: d 12.04.02, 00:26 zarchiwizowany

http://www.danielpipes.org/

First, the shadowy nature of the organizations that claim responsibility for
suicide actions points to the involvement of government intelligence
organizations. While terrorist organizations want to become known and feared,
states wish to stay out of the limelight. Doubts about the existence of Islamic
Jihad, an organization first heard of in May 1982 and widely associated with
suicide activities, are in themselves reason to suspect it of being a front for
Iranian intelligence.

Second, the intricacy of plans points to government involvement, for these go
beyond the capabilities of small organizations. Car-bombings against American
and French installations showed enormous sophistication. In almost every case,
the vehicle went unerringly to the most vulnerable spot of the building under
attack. The strikes took place at the right moment and took exact advantage of
weaknesses in the defense system. Such mastery suggests extensive intelligence
connections, weeks of planning, elaborate model-building, and careful training.

Third, the explosions themselves betray state sponsorship. The truck that
destroyed the U.S. Marine barracks, for example, contained the equivalent of
over 12,000 pounds of TNT; the explosion it caused was called in the Long
Commission Report "the largest conventional blast ever seen by the explosive
experts community." So massive was the blast, the Report states, it would have
caused major damage and many casualties even if it had exploded on the open
road 330 feet away from the building. To mount such capabilities into a
Mercedes truck that carries considerably less than 12,000 pounds, TNT was mixed
into a complex of gas and other substances. The difficult and delicate task of
gas-enhancement requires the sort of specialized skills and wealth of
experience possessed by a state, not an outlaw organization. Further, the use
of highly controlled explosive materials as hexogen and PETN indicates the
involvement of intelligence agencies.

Fourth, the price of these operations puts them out of the reach of small
organizations. Safe houses, explosives, and Mercedes trucks are expensive in
themselves, but timely and accurate intelligence is the most costly. According
to sources cited by Thomas L. Friedman of the New York Times, a single bit of
information for the April 1983 embassy bombing cost about $30,000.

Fifth, some of the suicides acknowledge allegiance to the leaders of states.
Before driving to her death in a booby-trapped car, a 16-year-old Lebanese girl
sent greetings to "the leader of the liberation and steadfastness march, Lieut.
General Hafiz al-Asad." One of Amal's leaders, Mahmud Faqih called
Khomeini "our legitimate leader" and called Iran "our shield and source of
support... the source of our conceptual, ideological, and political strength."
The same goes for Hizbullah. 'Abbas Musawi, leader of this group, states that
Khomeini "spells out the movement's line and issues Hizbullah directives." When
asked about the financing of Hizbullah, Musawi admits that "the money comes
mainly from Tehran."

Sixth, intelligence information indicates links to states. Iran is known to
have dispatched a special plane to Damascus with 50 operatives on board a few
weeks before the Marine barracks explosion. Tehran gave the signal to attack
the eleven installations in Kuwait in December 1983 by sending a special
courier. In some cases, the names of individuals carrying out Iran's orders to
the suicide attackers, their activities, and the pay they received are known.
Senator Jesse Helms has released information showing that the Iranians helped
plan the logistics of the TWA hijacking in June 1985, trained at least one of
the hijackers in Iran, and provided money for the operation. Documents made
available by the Iranian opposition indicate that the Iranian government has
official organizations devoted to promoting suicide terrorism.

Seventh, the testimony of a number of participants in suicide bombings provides
first-hand reports on the involvement of states. Muhammad 'Ali Aryafar, an
Iranian navy captain who defected, told a news conference in August 1984
that "Islamic Jihad is backed by the Khomeini regime." According to him, the
Iranian Revolutionary Guards sent several units to train and advise the
terrorists in Lebanon-a fact confirmed by an American officer in congressional
testimony. Unwilling suicide bombers have provided similar evidence. The
Lebanese man who set off a massive explosion in Damascus told Syrian television
that his career as a suicide bomber began with a traffic accident. A truck
driver, he accidentally killed an Iraqi army officer in Baghdad last November
and was imprisoned for fifty-two days. Iraqi intelligence officers then gave
him a choice between execution or going to Damascus with a car bomb. He decided
on the latter and was dispatched to destroy the Syrian army officer club on its
most crowded night.

Eighth, states profit from suicide attacks. Tehran extends its influence in
Lebanon with this instrument. Similarly, the Syrian government uses suicide
bombings to show that its ideology-a mixture of pan-Syrianism and pan-Arabism-
has vitality and support in Lebanon. The PLO and Libya, whose terrorist
credentials have diminished from a decade ago, use suicide missions to reassert
their reputations.

Lastly, political leaders admit to terrorism. The Iranian government supported
the seizure of the U.S. Embassy in Tehran and has since made no effort to
disassociate itself from a great number of terrorist incidents in Lebanon,
Kuwait, and elsewhere. The PLO claims almost every day to execute terrorist
actions against Israel. Early in 1986, Qadhdhafi declared he would train
suicide squads "for terrorist and suicide missions and allocate trainers for
them and place all the weapons needed for such missions at their disposal."
Walid Jumblatt, the Druze leader of Lebanon, recently promised to send suicide
squads to help Qadhdhafi against the United States. Only the Syrian government
denies its role in support of terrorism.

A Tool of Statecraft
State sponsorship takes the mystery out of suicidal actions. It removes these
acts from the realm of aberrant pathology, religious fanaticism, and political
extremism, and places them instead within the scope of institutional power and
intelligence activities.

Many of the actions which appear to be undertaken suicidally turn out not to
be. Some drivers-such as the Lebanese engaged as a result of a traffic mishap
in Iraq-were blackmailed. A 16-year-old Lebanese, Muhammad Mahmud Burru, stated
in April 1985 that he had been recruited under duress. According to Burru's
account, he was working for Amal, the Syrian-supported Shi'i organization, when
he one day rode his motorcycle into the back of a car. Responding to Burru's
request, Amal officials got him out of this problem. A few months later, his
father too caused a car accident, injuring himself and a young woman. Burru was
threatened shortly after: if he did not undertake a suicide mission for Amal,
the file on his motorcycle accident would be reopened, his father would go
without a needed operation, he and his father would lose their jobs, and his
whole family would be persecuted by the woman's relatives. After days of
agonizing indecision, he reluctantly chose the mission and was assigned a car
packed with 400 pounds of explosives to drive into an Israeli military
headquarters.

Muhammad an-Nasir, who was to drive a rigged car to a southern Lebanese sentry
station in September 1985, was the most obviously unwilling suicide. He acted
in so untrustworthy a fashion that a car followed him to make sure he followed
orders. But just before reaching the designated checkpoint, Nasir left his
vehicle

Vist.....wild2

• &# 9619;&# 9619;&# 9619;&# 9619;&# 9619;&# 9619;
drf 30.07.02, 15:24 zarchiwizowany

Gość portalu: ▓▓▓▓▓▓▓▓ napisał(a):

212.25.68.49/
▓▓▓▓▓▓


• Re: ______________________Thetismoon
drf 30.07.02, 15:23 zarchiwizowany

Gość portalu: Vist¸ napisał(a):

>
>
>
www.digitalblasphemy.com/dbgallery/3/thetismoon.shtmlhttp://www.polskaludowa.com/dokumenty/Marzec68/broszura_kwpzpr.htm


• Re: Toruń ______________________?
drf 30.07.02, 15:22 zarchiwizowany

www.polskaludowa.com/dokumenty/Marzec68/broszura_kwpzpr.htm


• Re: --------------------AQUANET------------------
drf 30.07.02, 15:21 zarchiwizowany

www.polskaludowa.com/dokumenty/Marzec68/broszura_kwpzpr.htm


• PRZERWA OBIADOWA !!!! n/t
drf 30.07.02, 01:05 zarchiwizowany



• spaudaj z tyuogo wontku !!! IP: *.cm-upc.chello.se
Gość: Musad 30.07.02, 01:03 zarchiwizowany

i tou jusz !!


• inflacja jezykowa ? IP: *.cm-upc.chello.se
Gość: _:_ 30.07.02, 01:01 zarchiwizowany

\\\\\\\


• flisak cos-tam
zupa_nic 26.07.02, 21:32 zarchiwizowany

a kto ci kaze czytac to wszystko???
rozladuj swoje frustracje na innych stronach , skoro i tak placisz pieniadze za
pobyt w kafejce internetowej ;)


• Re: macie racje obydwa ale tylko w 50 % kazdy a j IP: *.tarnobrzeg.cvx.ppp.tpnet.pl
Gość: Ar 26.07.02, 21:11 zarchiwizowany

Ene-due rabbe połknął bociek żabę itd na podwórko bawić się w piaskownicy
a nie zabierać mamie ostatnie pieniądze na kawiarenkę internetową !


• Re: macie racje obydwa ale tylko w 50 % kazdy a j
zupa_nic 26.07.02, 21:01 zarchiwizowany

znaczy siem, nikt nie chce zarobic? ;)


• Re: macie racje obydwa ale tylko w 50 % kazdy a j
zupa_nic 25.07.02, 22:00 zarchiwizowany

.. platne w walucie_nic? ;))


• [...]
o_qrwa_to_sie_wyciaga_na_ 25.07.02, 21:54 zarchiwizowany

Wiadomość została usunięta ze względu na złamanie prawa lub regulaminu.


• Skåunska separatister
zupa_nic 25.07.02, 21:05 zarchiwizowany

Käre Dr F,
man skal inte tro påu allt som ståur i tidningar, speciellt DN ;) Och speciellt
inte nu i "gurkasesängen" ;))
Förvirrade människor finns ju överallt (t.o.m. på detta forum). Men vem tar dem
på allvar? :)))
Meud di euviga etc (ou en stour skål osså). Baura slappa auv, Dr, vi alla
beuhöver det :)))


• Re: ICOSAHEDRON !!!
drf 25.07.02, 08:29 zarchiwizowany

mvh fran norr
dn skriver att skaonska nasionalister
vill skapa en nytt land fritt fran
svenska okupanter...ar det sant?
pzdr dr f


• Re: ICOSAHEDRON !!!
zupa_nic 23.07.02, 19:58 zarchiwizowany

Mvh osåu :) Ousåu fråun M (s) Ziuta :)))
Ou skåul påu die ;))


• ICOSAHEDRON !!!
drf 23.07.02, 19:51 zarchiwizowany

www.altavista.com/sites/search/web?q=ICOSAHEDRON&pg=q&avkw=tgz&kl=XXhttp://www.dcs.st-and.ac.uk/~ad/mathrecs/polyhedra/icosahedron.html


• :::::::::::::::::::::::::AQUANET:::::::::::::::::: IP: *.cm-upc.chello.se
Gość: ng;ÅÅ 18.07.02, 19:03 zarchiwizowany

www.utm.edu/research/primes/lists/top20/ArithmeticProg2.html


• Re: Urban a Europa...
zupagrzybowa 09.07.02, 19:45 zarchiwizowany

www24.big.or.jp/~oil/my%20favorite%20things.html


• åö7«VòÕ ØífR´í^Áãre%wwy E|m IP: *.cm-upc.chello.se
Gość: 7«VòÕ ØífR´í^Áãre%wwy E|m 08.07.02, 16:16 zarchiwizowany

åö7«VòÕ ØífR´í^Áãre%wwy E|mokc2dJu…i~N
Š˜‡ƒJer‘“\ ‰˜Šš[œY?¡”’…
.¦¦¨ˆª?s®­°


• Re: --------------------AQUANET-----------------------
rosolek 07.07.02, 02:06 zarchiwizowany

www.aquanet.co.il/war2002/34.html


• : : e-soppa är cool : :
rosolek 05.07.02, 00:34 zarchiwizowany

barszcz_czerwony napisał(a):

rosolek napisał(a):

Ha en brau daug rödbeutsouppa! SoppaECool!
_____________
I synnerhet e-soppa är cool ;) men oftast blir til Soppa Ingenting :))
Hau eun brau daug, duå osså :)))

www.soupsong.com/iart.html



• Krotka historia Zup
rosolek 05.07.02, 00:27 zarchiwizowany

Revenge of Yavapai Warriors Who Were Refused Soup: The story of
Olive "Cloudwoman" Oatman began in 1851 when, as a 13-year-old child, she and
her large family left their wagon train and made their own way to California.
While eating a sparse meal of bread and bean soup on a remote Arizona plateau,
they were joined by Indian warriors. When her father refused to share the
soup, the offended warriors massacred the family with spears and clubs. Olive
and her little sister Mary were taken as slaves; brother Lorenzo was left for
dead. Olive and Mary went on to be traded to Mojave Indians for 2 horses,
vegetables, beads, and 3 blankets--where they were adopted as Mojave children.
Ultimately Mary died of famine and Olive was traded back into white society,
where she toured the country promoting her experiences before marrying and
disappearing from public view.


Captain Cook and Portable Soup in 1772: Anxious to secure whatever nutrition
for his crew that he could, Captain James Cook took cases of "portable soup,"
or soup-cake, on his 3-year voyage around the world. The oblong cake was
was "made by boiling and evaporating the most putrescent parts of the meat to
the consistency of glue." Some sailors were flogged for refusing to eat it.
One of these odd little now resides in the National Maritime Museum at
Greenwich, Engand. It's said that Sir Jack Drummond tasted a bit of it in the
1930s--reporting that it had "changed very little."


Blood Soup and Treachery: William Laird recounts in Karluck: The Great Untold
Story of Arctic Exploration the underside of Canadian Vilhjalmur Stefansson's
triumphant mapping and exploration of the Arctic in 1913-18. Although hailed
as a hero and awrded the Hubbard Medal, Stefansson is exposed as abandoning
the crew of his ship, the Karluk, in the early stages of his expedition.
Unable to return from his 10-day sojourn to trap carabou, he left the crew to
subsist for 6 months on blood soup, rotting blubber, belt leather, seal
flippers, and bird egg. Only 14 of the original 25 members survived--including
the author of the book, William Laird, who waited over 60 years to tell the
gruesome story.


Poisoned Soup, Hanged Cooks, and the Mutiny: Charles Allen recounts in Soldier
Sahibs the story of a hot night during the Indian Mutiny when Brigadier
General John Nicholson strode into the British mess tent at Jullunder, coughed
to attract the attention of the officers, then said, "I am sorry, gentlemen,
to have kept you waiting for your dinner, but I have been hanging your cooks."
He had been told that the regimental chefs had poisoned the soup with aconite.
When they refused to taste it for him, he force fed it to a monkey--and when
it expired on the spot, he proceeded to hang the cooks from a nearby tree.


"Er naderd' ons van Frankrijks grens
een troep,
die vroegen voor hun mager pens
de soep !!"
(etc.)
[or, Once came from the French border/ a troop,/ they asked for their meagre
belly,/ the soup. (etc.)]
This verse originated in 1796, when the French-- after their revolution and
still several years before Napolean rose to power--invaded the Netherlands.
Some welcomed them as liberators who would change the regime, once a great
power, from the rotten republic they believed it had become to a more
democratic one. Others, though--and the ones singing this verse--despised the
invading mob, which was both ill fed and ill dressed. And, truly, when the
French soldiers outfitted and fed themselves at the expense of the
Netherlanders, the French sent more of them. Many thanks to W. H. van der
Molen for contributing this piece of soup history.


Baden-Powell and Horsemeat Soup: Robert Baden-Powell provoked joyful
celebrations in London when, as a young colonel in South Africa's Boer War, he
led the defeat of the 9-month Afrikaner siege of the British military garrison
at Mafeking. History, however, has not been kind as one of his measures was to
order a mass evacuation of the garrison's black members--a racist "leave or
starve" policy that resulted in hundreds of deaths when evacuees were either
shot to death by Boers or starved. New sources, however, indicate that he
realized his mistake almost immediately, ordering remedial measures that
stocked emergency kitchens with horsemeat soup. Unfortunately, not before many
deaths occurred.


Buttocks Soup and the Case of the Tokyo Cannibal: On an evening in late March
1902, the body of an 11-year-old boy was found in a vacant lot near Yotsuya
Station in Tokyo. An autopsy revealed that the boy had been smothered, but
also noted an 18 cm. x 14 cm. strip of flesh missing from the boy's left
buttock. Although the case was never proven, police identified Noguchi
Osaburo, an eccentric university dropout who was later executed for another
murder, as the likely killer. His mentor and future father-in-law, poet
Noguchi Neisai, had been suffering from leprosy...and Osaburo knew that an old
Korean folk remedy for leprosy called for soup using the flesh taken from the
buttocks of a young child.


Popes and Soup: In Buon Appetito Santita! (1999), Mariangela Rinaldi and
Mariangela Vicini reveal that Pope John Paul II is no longer the trencherman
he once was, now subsisting only on soup, cheese, white meat, vegetables, and
white wine. Hadrian VI (1522-23), from the Netherlands, ate only soup, fish,
and apples.


Al Capone in the Soup Kitchen: It was the Depression in the 1930s, and
Gangster Al Capone shocked the city fathers by setting up Chicago's very first
soup kitchen. He paid $350 a day out of his own pocket to feed as many as
3,000 unemployed people. Rumor is, he was motivated less by human kindness
than to keep people from turning in evidence of his criminal activities.


The Lapps of northern Scandanavia largely remained nomads right into the 20th
century. How did they survive? Entirely off their reindeer herds, except in
summer when fish was an option. A family of six would go through a reindeer a
week, boiling the organ meets with the tongue and the tail into a soup and
making jerky out of the meat. Today Lapps are mostly settled and integrated
into society.


In 1930s Govan, Scotland, the story goes, a well-meaning upper-middle-class
lady lectured the wives of the unemployed at the Pearce Institute on how to
make a pot of soup with a cod's head. At question time, an old lady
asked, "Missus, whit happened tae the rest o' the fish?"


M. Boulanger, signalling the post-revolutionary end of great aristocratic
kitchens in France and the beginning of chefs making themselves commercially
available for the masses, put a sign (in Latin) outside his Parisian soup
restaurant in 1765, saying "Venite omnes qui stomacho laboratis, et ego
restauranto vos." [or, "Come all ye who labor with the stomach, and I will
restore you"]. Thus today's word "restaurant" from restauranto.


Michelangelo Buonarroti (1475-1564) really didn't want to paint the ceiling of
the Sistine Chapel--and even asked Pope Julius II to excuse him from the
project. According to Michele Saponaro, in Michelangelo, "He feared he would
prove unequal to the task...he despaired of his talent, fortune and future."
Soon, however, Michelangelo became so obsessed by the project that he refused
to leave the scaffolding and forced his servant to climb up on it to bring him
bread and a bowl of soup for his meals.





• Re: : KOSMICZNA ZUPA CEBULOWA
barszcz_czerwony 05.07.02, 00:22 zarchiwizowany

rosolek napisał(a):

> www.
> geocities.com/peterunde/Sound/FIVE.mp3

> Låt oss fira!
_____________
Visst, skåul i danskt bajer ;))
Och en klunk för den överansträngt Dr F :))))
... All that jazz föur faaaun... vad hände med Vikingarna? ;)
Och vad är du på?

Med DES (De Eviga Skåunska ;)



• Re: : ................................... Sanatorium p.
barszcz_czerwony 05.07.02, 00:15 zarchiwizowany

rosolek napisał(a):

> Ha en brau daug rödbeutsouppa! SoppaECool!
_____________
I synnerhet e-soppa är cool ;) men oftast blir til Soppa Ingenting :))
Hau eun brau daug, duå osså :)))



• : KOSMICZNA ZUPA CEBULOWA
rosolek 05.07.02, 00:10 zarchiwizowany

zupa_nic napisał(a):

sanatorium_psychiatryczne napisał(a):
soup.allrecipes.com/default.asp
to tylko metafory
________________
"Swiat jest jedna wielka Zupa Cebulowa i dlatego wszyscy na nim placza."
(zrodlo: Zupa Piwna, Dziela Zebrane, tom V)
_____________________________________________

www.geocities.com/peterunde/Sound/FIVE.mp3
Låt oss fira!


• : ................................... Sanatorium p.
rosolek 05.07.02, 00:06 zarchiwizowany

barszcz_czerwony napisał(a):

Hjärtligt tack för det historiska perspektivet på soppa-fenomenet ;)
Med euviga skåunska etc. ;)

Ha en brau daug rödbeutsouppa! SoppaECool!


• Re: ................................... Sanatorium p.
barszcz_czerwony 04.07.02, 23:59 zarchiwizowany

Hjärtligt tack för det historiska perspektivet på soppa-fenomenet ;)
Med euviga skåunska etc. ;)


• ................................... Sanatorium p. IP: *.cm-upc.chello.se
Gość: drFröjd 04.07.02, 23:55 zarchiwizowany

... Archaeological evidence indicates that primitive man was so keen to get
his hands on a bowl of soup that he wasn't prepared to wait for the
development of pots sturdy enough to cook the stuff in. Instead, he hit on the
scheme of placing a stone in the fire and dropping it, red hot, into a pre-
made liquid gruel to heat it up.
Things improved, at least in the UK, with the arrival of migrants from
Northern France in the fourth millennium BC. Au fait with the ways of farming,
they brought not only the basic ingredients for early soup (cultivated wheat
and barley plus sheep and goats), but also pottery know-how, spelling the end
of the old [heated] stone technique. This made boiling possible, and with it
the release of starch from cereals into the liquid, bringing about the all
important "soupy" texture.

Not all iron age soup recipes were any great shakes by modern standards.
Although residues clinging to pots found in a lake village in Switzerland
indicate a fairly appetizing stew of raspberry, strawberry, elderberry, wheat,
nuts and fish, the soup found in the stomach of Denmark's Tolland Man, found
in a bog in the '50s, has translated less effectively to the modern palate.
Indeed when it was reconstituted for a BBC documentary in 1954, the two
presenters who tried it almost brought it straight back up...

...[Back in Britain], the range of ingredients available for the soup pot was
vastly expanded by the arrival of goodies brought by the invading Romans in
the second century AD: leeks, onions, garden carrots, garlic, fennel, mint,
thyme, parsley and coriander to name but a few. Roman soups could be quite
complicated affairs. Perhaps the oldest surviving soup recipe in the world
appears in Apicus' fourth century cook book, based on the notes of a cook who
had died three centuries earlier. The soup in question is Pultes Iulianae, or
Julian Pottage, and the recipe is as follows:

First prepare a wheat gruel by boiling up some pre-soaked wheat with water and
a little olive oil, and stir vigorously to thicken. Then pound up half a pound
of minced meat in a mortar, with two brains, some pepper, lovage and
fennelseed, and add wine and liquamen (fermented fish sauce, a little like
modern South East Asian versions). Cook the mixture in a metal vessel, add
some stock, and add the result to the wheat gruel. Voila!..

Andrew Boorde, writing in 1598, describes something nearer the modern version
of soup, which he claimed was eaten throughout England: "Pottage is made of
the lyquor in whych flessche is sodden in, with puttyng to chopped herbs and
oatmeal and salt". The appearance of meat in this description is an indication
of the growth of prosperity during the Tudor and Elizabethan periods.

...The [18th] century saw two momentous developments. The first was the
invention of the first primitive stock cubes, like the "portable soup" Captain
Cook took with him on his round the world voyage of 1772. Made by evaporating
clarified broth until it reached the consistency of glue, this proto-Bovril
could be kept for years.

Still more important, particularly from the Soup Works point of view, was the
opening of Monsieur Boulanger's soup shop in Paris in 1765. This august
establishment was nothing less than the world's first restaurant, and it only
sold soup. The name derived from a sign hanging above the door which
read "Boulanger vends les restaurants magiques" ("Boulanger sells magic
restoratives"). As they say, what goes around comes around . . .

..[.In the U.S.] in the mid 1980s, Al's Soup Kitchen International opened for
business in midtown Manhattan , selling delicious fresh soups to ever growing
queues of hungry office workers. A kind of soupy Basil Fawlty, Al quickly
became a living tourist attraction on account of his legendarily stroppy
approach to his customers. He also made soup to die for.

Eventually, he reached the attention of the makers of the comedy series
Seinfeld, mandatory watching for New Yorkers, who parodied him in an episode
called The Soup Nazi. Suddenly, soup outlets started springing up everywhere
Daily Soup, Hale and Hearty, Mr Soup and the slightly suspiciously named Soup
Nutsy.

www.geocities.com/peterunde/







• Re: KOSMICZNA ZUPA CEBULOWA
zupa_nic 04.07.02, 23:33 zarchiwizowany

sanatorium_psychiatryczne napisał(a):

> soup.allrecipes
> .com/default.asp

> to tylko metafory
________________
"Swiat jest jedna wielka Zupa Cebulowa i dlatego wszyscy na nim placza."
(zrodlo: Zupa Piwna, Dziela Zebrane, tom V)



• Re: Sanatorium p.
barszcz_czerwony 04.07.02, 23:22 zarchiwizowany

To ja poprosze na oddzial kulinarny ;)


• KOSMICZNA ZUPA .....
sanatorium_psychiatryczne 04.07.02, 23:10 zarchiwizowany

soup.allrecipes.com/default.asp
to tylko metafory


• Re: KOSMICZNA ZUPA .....
zupa_nic 04.07.02, 22:20 zarchiwizowany

..... a po niej NIC....
Czy to przez Gwiezdne Wojny???


• KOSMICZNA ZUPA /nt
zupagrzybowa 04.07.02, 21:42 zarchiwizowany



• [...]
zupagrzybowa 04.07.02, 21:41 zarchiwizowany

Wiadomość została usunięta ze względu na złamanie prawa lub regulaminu.


• Re: Miedzynarodowa konspiracja zupna3!
zupa_nic 04.07.02, 21:16 zarchiwizowany

Haslo roku: Zupa Nic to jest COS !!!


• Re: Miedzynarodówka zup!
barszcz_czerwony 04.07.02, 21:15 zarchiwizowany

Barszcz czerwony rulez (dopoki bez dwoch grzybkow, a szczegolnie muchomorów ;)
ex equo z Zupa grzybowa !!!
Zupy calego swiata! Laczcie sie !!!


• Miedzynarodowa konspiracja zupna2! IP: *.cm-upc.chello.se
Gość: copy; 04.07.02, 21:09 zarchiwizowany

zupa_nic napisał(a):
najlepsza zupo swiata
masz racje
zupo_universalna
amen2




• Miedzynarodowa konspiracja zupna!
zupa_nic 03.07.02, 20:26 zarchiwizowany



• Shema Yisroel, Adonoi Elohinu, Adonoi Echod ! IP: *.cm-upc.chello.se
Gość: copy; 03.07.02, 20:19 zarchiwizowany

zupa_nic napisał(a):

Gość portalu: drF napisał(a):

nawzajem ...!

I >>SMACZNEGO<< tez!

©


• Re: Shema Yisroel, Adonoi Elohinu, Adonoi Echod !
zupa_nic 03.07.02, 20:18 zarchiwizowany

Gość portalu: drF napisał(a):

> nawzajem ...!

I >>SMACZNEGO<< tez!


• Re: Shema Yisroel, Adonoi Elohinu, Adonoi Echod !
o_qrwa_to_sie_wyciaga_na_ 03.07.02, 20:07 zarchiwizowany

Gość portalu: drF napisał(a):

> nawzajem ...!

ZYDZI OPANOWALI SWIAT !!!!!!!!!!!!!!!!!!!!!!!!!!!!
Autor: zupagrzybowa@poczta.gazeta.pl
Data: 03-07-2002 19:53


--------------------------------------------------------------------------------
www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&aid=2367639


--------------------------------------------------------------------------------


poprzedni pokaż treść wszystkich wiadomości


• DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu: Jude, 03-07-2002 16:52
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. werw, 03-07-2002 16:56
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. bimi, 03-07-2002 17:00
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu: jude, 03-
07-2002 17:03
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. bimi, 03-07-2002
17:10
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. zupagrzybowa, 03-07-2002 17:04
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu: jude, 03-07-
2002 17:17
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. zupagrzybowa, 03-07-
2002 17:24
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. bimi, 03-07-2002
17:26
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. zupagrzybowa,
03-07-2002 17:40
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. bimi, 03-
07-2002 17:47
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?.
zupagrzybowa, 03-07-2002 18:21
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość
portalu: BUrak, 03-07-2002 19:09
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu:
FAKEN, 03-07-2002 19:06
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu: faken, 03-07-
2002 19:04
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu: Jude, 03-07-2002
17:08
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. werw, 03-07-2002 17:37
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. bimi, 03-07-2002 17:43
• DO BIMI zupagrzybowa, 03-07-2002 18:27
• Re: DLACZEGO SWIAT NIE WIERZY ZYDOM?. Gość portalu:
Jude, 03-07-2002 18:28
• DO JUDE PZPR zupagrzybowa, 03-07-2002 18:49
• Re: DO JUDE PZPR Gość portalu: Jude, 03-07-2002
18:56
• Re: DO JUDE PZPRnr3 zupagrzybowa, 03-07-2002
19:10
• JUDE RAUS ! zupagrzybowa, 03-07-2002
19:12
• ZYDZI OPANOWALI
SWIAT !!!!!!!!!!!!!!!!!!!!!!!!!!!! zupagrzybowa, 03-07-2002 19:53



• Re: Shema Yisroel, Adonoi Elohinu, Adonoi Echod ! IP: *.cm-upc.chello.se
Gość: drF 03.07.02, 18:38 zarchiwizowany

nawzajem ...!


• Shema Yisroel, Adonoi Elohinu, Adonoi Echod !
zupagrzybowa 03.07.02, 16:49 zarchiwizowany

zupagrzybowa napisał(a):

///////////////////\\\\\\\\\\//////////\\\\\\\\\\\
www.idf.il
///////////////////\\\\\\\\\\//////////\\\\\\\\\\\

Shema Yisroel, Adonoi Elohinu, Adonoi Echod !


• ///////////////////\\\\\\\\\\//////////\\\\\\\\\\\
zupagrzybowa 03.07.02, 01:48 zarchiwizowany

///////////////////\\\\\\\\\\//////////\\\\\\\\\\\
www.idf.il
///////////////////\\\\\\\\\\//////////\\\\\\\\\\\



• ///////////////////\\\\\\\\\\//////////\\\\\\\\\\\
zupagrzybowa 03.07.02, 01:45 zarchiwizowany

Gość portalu: Zawisza napisał(a):
///////////////////\\\\\\\\\\//////////\\\\\\\\\\\///////////////////
\\\\\\\\\\//////////\\\\\\\\\\\///////////////////\\\\\\\\\\//////////
\\\\\\\\\\\///////////////////\\\\\\\\\\//////////\\\\\\\\\\\///////////////////
\\\\\\\\\\//////////\\\\\\\\\\\
> Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
> 2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
> państwa • Re: --------------------AQUANET----------------------- Gość
portalu: Zawisza, 02-07-2002 15:55
• Re: --------------------AQUANET----------------------- Gość portalu:
Zawisza, 02-07-2002 15:55
• Re: --------------------AQUANET----------------------- Gość portalu:
Zawisza, 02-07-2002 15:56
• Re: --------------------AQUANET----------------------- Gość portalu:
Zawisza, 02-07-2002 15:56
• Re: --------------------AQUANET----------------------- Gość portalu:
Zawisza, 02-07-2002 15:57
• Re: --------------------AQUANET----------------------- Gość portalu:
Zawisza, 02-07-2002 15:57
///////////////////\\\\\\\\\\//////////\\\\\\\\\\\///////////////////
\\\\\\\\\\//////////\\\\\\\\\\\///////////////////\\\\\\\\\\//////////
\\\\\\\\\\\///////////////////\\\\\\\\\\//////////\\\\\\\\\\\///////////////////
\\\\\\\\\\//////////\\\\\\\\\\\///////////////////\\\\\\\\\\//////////\\\\\\\\\\\



• Re: --------------------AQUANET----------------------- IP: *.ae.poznan.pl
Gość: Zawisza 02.07.02, 15:57 zarchiwizowany

Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
państwa


• Re: --------------------AQUANET----------------------- IP: *.ae.poznan.pl
Gość: Zawisza 02.07.02, 15:57 zarchiwizowany

Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
państwa


• Re: --------------------AQUANET----------------------- IP: *.ae.poznan.pl
Gość: Zawisza 02.07.02, 15:56 zarchiwizowany

Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
państwa


• Re: --------------------AQUANET----------------------- IP: *.ae.poznan.pl
Gość: Zawisza 02.07.02, 15:56 zarchiwizowany

Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
państwa


• Re: --------------------AQUANET----------------------- IP: *.ae.poznan.pl
Gość: Zawisza 02.07.02, 15:55 zarchiwizowany

Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
państwa


• Re: --------------------AQUANET----------------------- IP: *.ae.poznan.pl
Gość: Zawisza 02.07.02, 15:55 zarchiwizowany

Jakub Mazur oskarża balcerowicza o zdradę Polski w tygodniku Głos z 29 czerwca
2002r. Tyutuł artykułu "Likwidacja polskiej zlotówki likwidacja polskiego
państwa


• Re: W Barszczu Przygód? IP: *.cm-upc.chello.se
Gość: y; 02.07.02, 02:17 zarchiwizowany

BOHM (s. 202): Materia, która z punktu widzenia fizyki jawi się jako materia
gęsta, zbudowana jest w rzeczywistości z pustej przestrzeni zawierającej kilka
bardzo małych cząstek krążących jak planety. Inne wysokoenergetyczne cząstki
przechodzą przez to, co wydaje się być stałą materią. Wprawdzie można uważać,
iż same cząstki są bardziej gęste, to jednak gdy weźmiemy pod uwagę teorię
względności i teorię kwantów, okaże się, że materia musi być pojmowane również
jako pole, a same jego cząstki jako zagęszczenia. Pole jest czymś uniwersalnym
i rządzą nim prawa teorii kwantowej. W moim odczuciu prawa te tak naprawdę
rozumiane są przez fizyków bardzo powierzchownie; jesteśmy jednak w stanie
wyciągnąć z nich kilka wniosków. Jeden z nich głosi, że pole zbudowane jest z
wielu rodzajów fal. Każda fala ma pewien minimalny ładunek ruchu przybierający
dyskretną postać kwantu. Dla każdej fali istnieje minimalna energia, która
jest niezbyt wielka, ale w pustej przestrzeni jest tak wiele fal, że ładunek,
w jaki się one sumują jest ogromny. W rzeczywistości, jeżeli dopuścimy
istnienie fal dowolnie krótkich, energia będzie nieskończona. A jeżeli
znajdziemy jakąś rację, żeby ją ograniczyć (a mamy taką rację) w tych
miejscach, gdzie możemy oczekiwać zawalenia się teorii, to gdy oszacujemy
energię, okaże się, że w jednym centymetrze sześciennym pustej przestrzeni
jest ona większa od energii, która wyzwoliłaby się przy anihilacji całej
materii zawartej w poznanym wszechświecie. Skłania to do wniosku, że znana nam
materia jest małą zmarszczką na pustej przestrzeni. W pewnym sensie przestrzeń
jest bardzo gęsta, w innym sensie nie jest; przestrzeń jest bowiem ruchem i to
ruchem bardzo złożonym.*BOHM (s. 44): Pole kwantowe zwiera informacje na temat
całego otoczenia i całej przeszłości i ta informacja reguluje obecną aktywność
elektronu w ten sam sposób, w jaki informacja o całej przeszłości i całym
otoczeniu reguluje za pośrednictwem świadomości naszą własną, ludzką
aktywność.*BOHM (s. 46): [...] ewolucja jest zasadą podstawową. Dotyczy to
zarówno przestrzeni jak i czasu. Sam czas jest porządkiem przejawiania się.
Powiemy zatem, że ukryty porządek możliwy jest zarówno w odniesieniu do czasu,
jak i do przestrzeni, że w dowolnym danym okresie czas może zostać całkowicie
zwinięty. Płynący czas jest w ukrytym porządku. Rzeczywistość jest ruchem
całościowym, a to co się dzieje w samej głębi danej chwili zawiera informację
o całości.*BOHM (s. 46): Świadomość jest być może najsubtelniejszą formą
materii i ruchu, bardziej subtelnym aspektem ruchu całościowego. W porządku
niejawnym przestrzeń i czas nie są od siebie oddzielne. Dotyczy to zarówno
zwyczajnej materii, jak i w większym nawet stopniu, materii subtelnej, jaką
jest świadomość. Jeżeli więc jesteśmy oddzieleni, to dlatego, że trzymamy się
przeważnie świata jawnego jako podstawowej rzeczywistości, gdzie wszystko
polega na istnieniu odrębnych, w każdym razie do pewnego stopnia, jednostek,
które na siebie wzajemnie oddziałują. W rzeczywistości niejawnej wszystko
wzajemnie się przenika, łączy się ze sobą - wszystko jest jednością. Gdzieś
głęboko świadomość ludzkości jest jedna. Jest to faktyczna pewność, ponieważ
nawet w próżni materia jest jedna; jeżeli tego nie widzimy, to tylko dlatego,
że nie chcemy tego widzieć.*BOHM (s. 47): W ciszy lub w pustce nie ma ani
miary przestrzeni, ani miary czasu. Otóż w owej ciszy może pojawić się mała
zmarszczka, posiadająca tę miarę. Myśląc jednak, że mała zmarszczka jest
wszystkim co tam jest, że przestrzeń wokół niej jest niczym, czymś bez
znaczenia, powracalibyśmy do zwyczajnego poglądu, w którym wszystko rozbite
jest na fragmenty.*BOHM (s. 106): W mechanice kwantowej mamy pola informacji w
funkcji falowej i być może pola super-kwantowe rządzące samym polem kwantów.
Pola nie znajdują się w czasoprzestrzeni, ale w przestrzeni wielowymiarowej -
tak jest w każdym razie w ujęciu matematycznym. Przestrzeń i czas są również
pojęciami antropomorficznymi. Są one sensami. Jeżeli powiemy, że ta
superfalowa funkcja nie rządzi sama przestrzenią i czasem, to mamy wtedy pole
o innym charakterze. Ale sensy czasoprzestrzenne i pole funkcji superfalowej
mogą się ze sobą kontaktować, podobnie jak mogą się kontaktować wszystkie
sensy wchodzące tu w grę.*EINSTEIN (s. 176): Doświadczenie mistyczne jest
najpiękniejszym przeżyciem. Jest one siłą wszelkiej prawdziwej sztuki i nauki.
Ten, któremu to doświadczenie jest obce, jest jakby martwy. Wiedzieć, że
istnieje coś, czego nie potrafimy przeniknąć, co przejawia się jako najwyższa
mądrość i olśniewające piękno, a dla naszego tępego umysłu dostępne jest w
swoich najprymitywniejszych postaciach - oto wiedza i uczucie znajdujące się w
centrum prawdziwej religijności. W tym sensie, i tylko w tym, należę do ludzi
głęboko religijnych. Istota ludzka jest częścią całości [...] Człowiek
doświadcza siebie, swoich myśli i odczuć jako oddzielnych od całej reszty.
Jest to rodzaj złudzenia optycznego, któremu ulega ludzka świadomość. To
złudzenie jest pewnego rodzaju więzieniem zamykającym nas w kręgu naszych
osobistych pragnień i uczuć żywionych wobec kilku najbliższych osób. Naszym
zadaniem powinno być wyzwolenie się z tego więzienia przez poszerzenie zasięgu
tego współczucia tak, żebyśmy objęli nim wszystkie żyjące istoty i całą naturę
w jej pięknie. Nikt nie jest w stanie osiągnąć tego w pełni, ale już samo
usiłowanie jest częścią wyzwolenia i ugruntowania wewnętrznego
bezpieczeństwa.*BOHM (s. 206): Jest tu pewna analogia w tym sensie, że
wszystko co przydarza się cząstce, zależy od tego, co przydarzyło się
wszystkim innym rzeczom w przeszłości. Jest to rozwijająca się w
nieskończoność sieć wzajemnych połączeń. Ale pojedyncza cząstka nie ma
oczywiście wyboru. W fizyce, cząstka porusza się po prostu zależnie od
działających na nią sił; siły te mogą osiągnąć ogromny zakres czasowego
oddziaływania. Pewne czynniki mogą być zaniedbywalne, inne zaś, jako
silniejsze, nie. Jeśli jednak chodzi o wszechświat, musisz myśleć o nim jako o
takiej właśnie sieci wzajemnych połączeń między cząstkami. W fizyce cząstki
mogą powstawać z energii albo ulegać anihilacji łącząc się ze sobą. Jakkolwiek
więc cząstki mogą istnieć długo, nie jest konieczne, żeby istniały stale.
Uważa się obecnie, że każda cząstka ma ograniczony czas istnienia. Dotyczy to
nawet protonu, w przypadku którego czas ten może być nawet milion razy większy
od obecnego wieku wszechświata. Koniec końców jednak, każda cząstka i każda
struktura cząstek rozpada się.*BOHM (s. 208): Dlaczego kamień musi pozostać
kamieniem i nie może stać się czymś innym? Zastanówcie się nad tym jak rośnie
roślina: wkłada się do ziemi nasiono, ale materiał pochodzi ze słońca, wody i
gleby. Wszystko to gromadzi się razem samorzutnie i tworzy roślinę.
Współczesna nauka stwierdza, że nasiono dostarcza przede wszystkim informacji
w postaci DNA. Roślina powstaje wtedy, gdy DNA dostarczy tej informacji.
Podobnie jest ze zwierzęciem. Sądzę, że tak jak mówi się o DNA, że ma ono coś
w rodzaju proto-inteligencji - trochę innej niż nasza inteligencja - podobnie
materia posiada pewien rodzaj proto-inteligencji sterowanej subtelną
informacją. Jednak w ostatecznym rachunku niezbędne jest całe otaczające
środowisko, które realizuje tę inteligencję - stąd bowiem pochodzi materiał.
Trzeba więc zrozumieć zdolność do reagowania na informację - być może jest ona
jakoś pokrewna inteligencji, mimo że nie jest z nią identyczna.*DALAJLAMA (s.
208): Uważam, że bez poznania świadomości bardzo trudno jest gruntownie poznać
materię. Jeśli natomiast znamy współczesne, naukowe sposoby objaśniania
materii, powinno to być pomocne w lepszym wyjaśnieniu świadomości. My,
buddyści, wierzymy, że na rzeczywistość składają się dwie siły: materia i
świadomość. Oczywiście, świadomość z


• medytacja.budda.pl IP: *.cm-upc.chello.se
Gość: /\\\/\/\ 01.07.02, 19:39 zarchiwizowany

matrix.budda.pl/


• www.us-israel.org
datsh 01.07.02, 15:28 zarchiwizowany

www.us-israel.org/jsource/bibliowf.html


• --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: copy; 01.07.02, 01:06 zarchiwizowany

www.us-israel.org/jsource/myths/mftoc.html


• Hitch Hickers Guide to the Galaxy
alef1 27.06.02, 22:39 zarchiwizowany

www.francesj.btinternet.co.uk/hitchhikers.html
hinux.hin.no/~bud/hitch.html


• # 8226 IP: *.cm-upc.chello.se
Gość: # 8226 27.06.02, 19:14 zarchiwizowany

# 8226 # 8226 # 8226 # 8226 # 8226 # 8226 # 8226 # 8226 # 8226 # 8226 # 8226
# 8226 # 8226 # 8226 # 8226


• &# 8226; I z r a e l z w y c i ę ż y ! Gość portalu: IP: *.cm-upc.chello.se
Gość: I z r 27.06.02, 18:40 zarchiwizowany

• I z r a e l z w y c i ę ż y ! Gość portalu: Datsh, 30-10-2001 04:54
Re: I z r a e l z w y c i ę ż y ! kanadol, 30-10-2001 05:24
kanadol o zydowskiej pamieci:-))) Gość portalu: Datsh, 30-10-2001 16:54
HEIL HITLER Gość portalu: A.HITLER, 02-06-2002 22:46
HITLER JUZ ZDECHŁ...! Gość portalu: DrFCK, 13-06-2002 00:43
HEIL HITLER Gość portalu: HITLER, 02-06-2002 22:47
HITLER JUZ ZDECHŁ...! Gość portalu: DrFCK, 15-06-2002 01:30
HEIL HITLER Gość portalu: HITLER, 02-06-2002 22:49
HITLER JUZ ZDECHŁ...! Gość portalu: DrFCK, 15-06-2002 02:17
Re: I z r a e l z w y c i ę ż y ! ptwo, 29-11-2001 21:03
SZOKUJACE ZDJECIA ZBRODNI ARMII IZRAELA Gość portalu: whoever, 09-04-2002
21:42
SZOKUJACE ZDJECIA ZBRODNI alef1, 16-04-2002 23:48
SZOKUJACE ZDJECIA ZBRODNI Gość portalu: al Haj, 25-06-2002 17:16
• do p. Datsh Gość portalu: oli, 30-11-2001 17:02
• Re: do p. OLI Gość portalu: Datsh, 19-12-2001 20:10
• Re: do p. Datsh Gość portalu: Moni, 28-03-2002 14:19
• 12 przykazan NSDAP Gość portalu: #, 14-12-2001 01:35
• GENERAL PRINCIPLE OF X Gość portalu: X, 20-01-2002 15:33
• A Chance Dialogue with a Contemporary Nazi Gość portalu: NY, 29-01-2002
19:09
• A Chance Dialogue with a Contemporary Nazi 2 Gość portalu: NY, 29-01-
2002 19:55
• A Chance Dialogue with a Contemporary Nazi 3 Gość portalu: NY, 29-
01-2002 19:58
• Re: A Chance Dialogue with a Contemporary Nazi 4 Gość portalu: NY, 29-01-
2002 20:00
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: )))-(((, 22-12-2001
02:49
• Re: do wyzej Gość portalu: Fix, 07-04-2002 03:52
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Durango, 04-01-2002
00:29
• www.stopthehate.net Gość portalu: :():, 16-01-2002 03:13
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Pawel, 19-05-2002 03:44
• dyskusja z ihvh Gość portalu: :::©:::, 22-06-2002 10:29
• D l a D a t s h ! ! ! quickly, 30-10-2001 05:25
• Re: D l a quickly ! ! ! :) Gość portalu: Datsh, 30-10-2001 17:17
• Wiedziałem, że nie brak tu żydowskich szaleńców. Gość portalu:
nik, 30-10-2001 05:43
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. Gość portalu:
archimed, 30-10-2001 07:52
• Ile wojen może PRZEGRAĆ Izrael? Gość portalu: archimed, 30-10-2001
07:57
• Ile wojen moga PRZEGRAĆ Muzulmanie? Gość portalu: slup, 30-10-2001 12:40
• Re: Ile wojen moga PRZEGRAĆ Muzulmanie? Gość portalu: Datsh, 30-10-
2001 18:13
• Re: Ile wojen moga PRZEGRAĆ Muzulmanie? Gość portalu: Tomcio, 13-12-
2001 22:17
• Re: Ile wojen może PRZEGRAĆ Izrael? Gość portalu: Datsh, 30-10-2001 18:03
• Re: Ile wojen może PRZEGRAĆ Izrael? Gość portalu: j@n, 06-03-2002
19:33
• .....odpowiedzialnosc za los swiata............... Gość portalu:
*, 06-03-2002 20:03
• Re: Ile wojen może PRZEGRAĆ Izrael? Gość portalu: j@n, 06-03-2002 19:21
• NIE dla TERRORYZMU NAZISLAMU !!!! Gość portalu: !, 06-03-2002 20:00
• DO ANDRZEJA NOWICKIEGO Gość portalu: Datsh, 01-11-2001 02:22
• Re: DO ANDRZEJA NOWICKIEGO Gość portalu: U, 01-11-2001 19:20
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. Gość portalu:
Jacek, 05-11-2001 11:51
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. ptwo, 29-11-
2001 21:09
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. Gość portalu:
archimed, 30-10-2001 07:55
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. Gość portalu:
puls, 30-10-2001 08:21
• Puls jest dalekowzroczny :) Gość portalu: Datsh, 30-10-2001 18:28
• Re: DO DATSH Gość portalu: puls, 30-10-2001 18:43
• Re: DO PULS Gość portalu: Datsh, 30-10-2001 19:48
• Re: DO PULS Gość portalu: puls, 30-10-2001 20:30
• Re: DO PULS Gość portalu: Datsh, 30-10-2001 20:39
• Re: DO PULS Gość portalu: U, 01-11-2001 19:30
• Re: DO___ U___ o Ali Babie ___i ___krowach Gość portalu: Datsh, 02-11-2001
00:59
• Re: DO___ U___ o Ali Babie ___i ___krowach Gość portalu: U, 02-11-2001
16:26
• Re: DO___ U___ o Ali Babie ___i ___krowach... Gość portalu: Datsh,
02-11-2001 19:59
• Re: DO___ U___ o Ali Babie ___i ___krowach Gość portalu: Wan, 03-
11-2001 09:14
• coś się komuś pokręciło ptwo, 29-11-2001 21:43
• Re: DO U o przyjażni i złodzejach ... Gość portalu: Datsh, 02-11-2001
01:39
• Re: DO U o przyjażni i złodzejach ... Gość portalu: U, 02-11-2001
16:34
• Re: Wielki Czlowiek U ! Gość portalu: Datsh, 02-11-2001 20:34
• Re: Wielki Czlowiek U ! Gość portalu: U, 08-01-2002 04:10
• Re: Wielki Czlowiek U ! Gość portalu: Datsh, 08-01-2002 15:47
• Re: DO Datsh Gość portalu: Normalna, 31-10-2001 17:13
• Re: DO NORMALNEJ ?-) Gość portalu: Datsh, 31-10-2001 18:16
• Re: DO PULS Gość portalu: Peres, 07-12-2001 17:40
• A Plan for Arafat Gość portalu: *""""""*, 14-12-2001 01:20
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. tatrzan, 31-10-
2001 11:49
• DO TATRZANA Gość portalu: Datsh, 31-10-2001 18:41
• ale IZRAELzwycieza i wcale nie zamieza przegrac... Gość portalu: waldus,
07-11-2001 19:24
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. Gość portalu:
Datsh, 30-10-2001 17:26
• DO NIK Gość portalu: Datsh, 01-11-2001 02:30
• Walka z terrorem Gość portalu: !, 08-11-2001 12:51
• Re: Walka z terrorislamcami trwa datsh, 30-04-2002 16:56
• Re: Wiedziałem, że nie brak tu żydowskich szaleńców. ptwo, 29-11-2001
21:06
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: grogreg, 30-10-
2001 11:09
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Datsh, 30-10-2001 18:47
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: grogreg, 31-10-2001
11:09
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Datsh, 31-10-2001 19:12
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: grogreg, 02-11-2001
15:05
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Datsh, 02-11-2001
21:14
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: grogreg, 05-11-2001
10:52
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Mirek, 08-01-2002 04:48
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Dr.FröJD, 17-01-2002
22:13
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: tomcio, 18-01-2002
16:44
• drobna pomylka :) Gość portalu: Misza, 30-10-2001 12:11
• Re: drobna pomylka :) Gość portalu: Vist¸, 30-10-2001 14:50
• DO VISTA :) Gość portalu: Datsh, 31-10-2001 23:19
• Re: drobna pomylka :) Gość portalu: Datsh, 30-10-2001 16:06
• Spasibo Gość portalu: Misza, 30-10-2001 16:30
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: puls, 30-10-2001
18:58
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: Datsh, 30-10-2001 20:03
• Re: Wojo!. Do raportu! Gość portalu: puls, 30-10-2001 20:55
• Re: Wojo!. Do raportu! Gość portalu: Datsh, 30-10-2001 21:48
• Re: Wojo!. Do raportu! Gość portalu: puls, 30-10-2001 21:58
• Re: Wojo!. Do raportu! Gość portalu: Datsh, 30-10-2001 22:17
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: U, 01-11-2001 19:49
• Re: I z r a e l z w y c i ę ż y ! Gość portalu: U, 02-11-2001 16:46
• Re: I z


• jedi IP: *.cm-upc.chello.se
Gość: copy; 27.06.02, 10:02 zarchiwizowany

©


• 666 IP: *.cm-upc.chello.se
Gość: copy; 27.06.02, 04:33 zarchiwizowany

• CO ON ZAWINIL PALESTYNCZYKOM ZE ZAMORDOWALI GO? (2) 27-06-2002, 04:21:34

• WHAT DID SHE HAD TO DO WITH POLITICS?????????????? (4) 27-06-2002,
04:20:52

• USA -American Forces Press Service (208) 27-06-2002, 04:17:44

• PLEASE OPEN YOUR HEARTS TO THE VICTIMS OF MURDER! (39) 27-06-2002,
04:14:45

• _______SHARON__CZYTA____FORUM__SWIAT!!!!!!!!!!!!!! (8) 27-06-2002,
03:57:10

• I z r a e l z w y c i ę ż y ! (666) 27-06-2002, 03:53:06

• Tylko do Kingfish !!!!!! (14) 27-06-2002, 03:48:12

• Rosja to potęga a Polska zdaje się tego niezauważa (97) 27-06-2002,
03:45:41

• ? (2) 27-06-2002, 03:35:31

• ISLAMSCY-TERORYSCI_CHCIELI_WYSADZIC_KATEDRE_W-BOLO (15) 27-06-2002,
03:22:11

• ..............................CAABA* MOsad*TALHmud (2) 27-06-2002,
03:00:51

• Fredzio - obywatelstwa nie chca ci dac ??? (13) 27-06-2002, 02:51:44

• POLACY WCALE NIE TACY GLUPI... wg. CNN (3) 27-06-2002, 02:37:56

• Rodzinne uczucia w islamie (79) 27-06-2002, 02:08:42

• Co zwykly Arab z Izraela mysli o fanatykach.. (16) 27-06-2002, 02:01:43

• Ludobojstwo w Sudanie !! (39) 27-06-2002, 01:57:59

• Antysemicka genetyka (19) 27-06-2002, 01:50:53

• Dlaczego Belgia odrzucila pozew p-ko Szaronowi ? (7) 27-06-2002, 01:24:03

• SWIAT ZADA: PRECZ Z ARAFATEM BO TERRORYSTA (6) 27-06-2002, 01:22:18

• Nowy Koszerny Czalg Merkava4 z naszym Silnikiem ! (5) 27-06-2002,
01:20:51

• Czy judaizm powinien byc zabanowany w Europie ? (2) 27-06-2002, 01:19:14

• NIEMCY MOGA ZADAC POWRUT MILIONY UCHODZCOW DO POLS (4) 27-06-2002,
01:09:51

• Dlaczego nie znosze Zydow (5) 27-06-2002, 01:02:07

• Saddam-exploiting dead babies, torturing children (8) 27-06-2002,
00:31:58

• Errare humanum U.S. (17) 27-06-2002, 00:29:59

• Polska mi nie chce Odac Polskie Obywatelstwo (92) 26-06-2002, 23:45:15

• >>>>>A_w_Izraelu_tosamo_arabstwo_dostaje_po_lapach (9) 26-06-2002,
23:17:20

• >>>>>>EU____niedlugo__bedzie___bardzo__goraco____! (8) 26-06-2002,
23:07:19

• ANDRZEJ- kanyś (1) 26-06-2002, 22:50:27

• WorldCom - kolejny przypadek ENRONitis (1) 26-06-2002, 22:36:43

• >>>>>>>>>Busch_:_z_terorystami_nie____rozmawiamy_! (28) 26-06-2002,
22:30:29

• _______JAK_JESTES_WOJO!!!_TO_SIE_TUTAJ_PODPISZ____ (58) 26-06-2002,
22:04:30

• Putin -miał pałę z geografi (131) 26-06-2002, 21:55:27

• NIEMCY MOGA ZADAC ZWRUT NIEMIECKICH ZIEMI OD POLSK (1) 26-06-2002,
21:43:15

• Bimi - the best of (18) 26-06-2002, 20:29:56

• UE - Polska: co można zyskać a co stracić? (83) 26-06-2002, 20:10:54

• "Jedyna demokracja na Bliskim Wschodzie" (25) 26-06-2002, 19:49:25

• NOWE_SLOWA/Jezyk_WYMYSLONy_PRZEZ_88/JEWHATER::::: (19) 26-06-2002,
19:22:51

• Czy pamiętacie taki brazylijski film "Macunaima"? (15) 26-06-2002,
17:05:33

• ARAFAT GLOWNY TERRORYSTA,IZRAEL WIEDZIAL OD DAWNA (2) 26-06-2002,
16:50:29

• We must be "politically correct" ... at all costs (1) 26-06-2002,
16:21:37

• Bimi! (13) 26-06-2002, 16:08:48

• IZRAEL W STANIE ZAATAKOWAC ATOMEM KAZDY PUNKT SWIA (5)


• http://www.walk4israel.com/ IP: *.cm-upc.chello.se
Gość: Datsh 27.06.02, 02:48 zarchiwizowany

www.walk4israel.com/


• Re: 6 6 6 IP: *.cm-upc.chello.se
Gość: y;:©: 27.06.02, 02:09 zarchiwizowany

Gość portalu: 666 napisał(a):

> no text
www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT
www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=2300157&aut=+%
3F&aid=2300157


• 6 6 6 IP: *.cm-upc.chello.se
Gość: 666 27.06.02, 02:06 zarchiwizowany

no text
www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT


• NIE IP: *.cm-upc.chello.se
Gość: NIE 26.06.02, 20:09 zarchiwizowany

www.nie.com.pl/main.php?dzial=forum


• ................................ Lewactwo
|||c||| 25.06.02, 20:13 zarchiwizowany



Odsyłacze "Anty-Burżuja"
(zagraniczne)
design (c) 1997 authorNet

MIĘDZYNARODOWE ORGANIZACJE LEWICOWE:
*
Biuletyn Informacyjny Centrum Szybkiej Informacji Wzajemnej
*
Dokumenty Internacjonalistyczne
*
Frakcja Trockistowska (Strategia Międzynarodowa)
*
Grupa Internacjonalistyczna
*
Internacjonalistyczna Grupa Komunistyczna
*
Komitet Koordynacyjny na rzecz Budowy Międzynarodowej Partii Robotniczej
*
Komitet Koordynacyjny na rzecz Budowy Międzynarodowej Partii Robotniczej
*
Komitet na rzecz Międzynarodówki Marksistowskiej
*
Komitet na rzecz Międzynarodówki Robotniczej
*
Komitet Organizacyjny Pryncypialnego Trockizmu (Czwarta Międzynarodówka)
*
Komitet Porozumiewawczy Bojowników o Rewolucyjną Międzynarodówkę Komunistyczną
*
Komitet Porozumiewawczy Międzynarodówki Robotników
*
Komunistyczna Organizacja Internacjonalistyczna - Czwarta Międzynarodówka
Komunistyczna Organizacja na Rzecz Czwartej Międzynarodówki
*
Komunistyczny Związek Internacjonalistyczny
*
Liga na Rzecz Czwartej Międzynarodówki
*
Liga na Rzecz Rewolucyjnej Międzynarodówki Komunistycznej
Liga na Rzecz Rewolucyjnej Międzynarodówki Komunistycznej
*
Międzynarodowa Jedność Robotników - Czwarta Międzynarodówka
*
Międzynarodowa Liga Komunistyczna (Czwartomiędzynarodówkowa)
*
Międzynarodowa Liga Robotników - Czwarta Międzynarodówka
*
Międzynarodowa Opozycja Trockistowska
*
Międzynarodowa Organizacja Socjalistyczna
*
Międzynarodowa Partia Komunistyczna
*
Międzynarodowa Tendencja Bolszewicka
*
Międzynarodowe Biuro na Rzecz Partii Rewolucyjnej
*
Międzynarodowe Centrum Ortodoksyjnego Trockizmu
*
Międzynarodowe Forum Socjalistyczne
*
Międzynarodowe Korespondencje Prasowe - organ Zjednoczonego Sekretariatu
Czwartej Międzynarodówki
Międzynarodowe Korespondencje Prasowe - organ Zjednoczonego Sekretariatu
Czwartej Międzynarodówki
*
Międzynarodowi Socjaliści
*
Międzynarodowy Komitet Czwartej Międzynarodówki
*
Międzynarodowy Komitet Porozumiewawczy na Rzecz Międzynarodówki Robotników
Międzynarodowy Komitet Porozumiewawczy na Rzecz Międzynarodówki Robotników
*
Międzynarodowy Komitet Robotników
*
Międzynarodowy Punkt Widzenia - organ Zjednoczonego Sekretariatu Czwartej
Międzynarodówki
*
Młoda Liga Socjalistyczna
*
Ogólnoafrykańska Ludowa Partia Rewolucyjna
*
Prawda - organ Międzynarodowego Sekretariatu Czwartej Międzynarodówki
*
Robotnik Środkowoamerykański
*
Socjalistyczna Partia Wolności
*
Tendencja Socjalistycznej Partii Robotniczej
*
-------------------------------------------------------------------------------
-
PARTIE I ORGANIZACJE LEWICOWE W RÓŻNYCH KRAJACH ŚWIATA:

Partia Pracujących (Algieria)
Algierska Partia na Rzecz Demokracji i Socjalizmu
*
Akcja Socjalistyczna (USA)
Praca Socjalistyczna (USA)
Socjalistyczna Partia Robotników (USA)
Organizator Socjalistyczny (USA)
Alternatywa Socjalistyczna (USA)
Liga na Rzecz Partii Rewolucyjnej (USA)
Socjalistyczna Partia Równości (USA)
Międzynarodowa Organizacja Socjalistyczna (USA)
Rewolucyjna Liga Robotnicza (USA)
Liga Trockistowska (USA)
Socjalizm (USA)
Marksistowska Grupa Robotników (USA)
Grupa Internacjonalistyczna (USA)
Labor Standard (USA)
Solidarność (USA)
Solidarność (USA)
Sieć Demokracji Robotniczej (USA)
News & Letters Committees (USA)
Światowa Partia Robotnicza (USA)
Komunistyczna Partia Stanów Zjednoczonych Ameryki
Młodzieżowa Liga Komunistyczna (USA)
Głos Komunistyczny (USA)
Robotnicza Partia Stanow Zjednoczonych Ameryki
USA - Liga Rewolucjonistów na Rzecz Nowej Ameryki
USA - Liga Rewolucjonistów na Rzecz Nowej Ameryki
Partia Pokoju i Wolności (USA)
Partyzant (USA)
Praca Walcząca (USA)
Liga Młodych Socjalistów (USA)
Socialistyczna Partia Pracy (USA)
Socjalistyczna Partia Pracy (USA)
Socjalistyczna Partia USA
Światowa Socjalistyczna Partia Stanów Zjednoczonych
Demokratyczni Socjaliści Ameryki
Partia Nowej Unii (USA)
Partia Pracy (USA)
Partia Pracy (USA)
Partia Rodzin Pracujących (USA)
Nowa Partia Wolności (USA)
Nowa Partia (USA)
Komitet na Rzecz Zjednoczonej Partii Niezależnej (USA)
Niezależna Sieć Postępowej Polityki
Afrykańska Ludowa Partia Socjalistyczna (USA)
Amerykański Ruch Indiański
Czarny Kongres Radykalny (USA)
Narodowy Czarny Zjednoczony Front (USA)
Klub Młodzieżowy "Spartakus" (USA)
Nowa Demokracja (USA)
The People's Weekly World (USA)
Huelgas Generales (USA)
Committees of Correspondence for Democracy and Socialism (USA)
*
Komunistyczna Partia Andaluzji
Lewica Andaluzyjska
JALEO - Andaluzyjska młodzieżowa organizacja narodowo-rewolucyjna
Naród Andaluzyjski
Partia Andaluzyjska
*
Rada Aragońska
*
Robotniczy Front Socjalistyczny (Argentyna)
Socjalistyczny Związek Pracownikow (Argentyna)
Konwergencja Socjalistyczna (Argentyna)
Grupa Socjalistyczna "Guernica" (Argentyna)
Ruch ku Socjalizmowi (Argentyna)
Rewolucyjna Liga Socjalistyczna (Argentyna)
Internacjonalistyczna Grupa Trockistowska (Argentyna)
Internacjonalistyczna Liga Robotnicza - Czwarta Międzynarodówka (Argentyna)
Komitet Robotniczej Inicjatywy Socjalistycznej (Argentyna)
Socjalistyczny Ruch Robotników (Argentyna)
Partia Robotników (Argentyna)
Partia Robotników na Rzecz Socjalizmu (Argentyna)
Rewolucyjna Partia Robotników (Argentyna)
Komunistyczna Partia Argentyny
Odbudowa Komunistyczna (Argentyna)
Partia Bolszewicka na Rzecz Czwartej Międzynarodówki (Argentyna)
Partia Robotników na rzecz Socjalizmu (Argentyna)
Związek Bojowników o Socjalizm (Argentyna)
Socjalistyczny Ruch Pracowników (Argentyna)
Robotnicza Partia Rewolucyjna (Argentyna)
Rewolucyjna Partia Pracowników
Narodowa Partia Rewolucyjna (Argentyna)
Socjalistyczna Liga Rewolucyjna (Argentyna)
Ruch na Rzecz Socjalizmu (Argentyna)
Ludowa Partia Socjalistyczna (Argentyna)
Prawdziwa Partia Socjalistyczna (Argentyna)
Nurt Tożsamości Socjalistycznej (Argentyna)
*
Lewica Asturii
Lewica Asturii
Blok Lewicy Asturyjskiej
*
Demokracja Socjalistyczna (Australia)
Socjalistyczna Partia Równości (Australia)
Socjalistyczna Partia Równości (Australia)
Międzynarodowa Organizacja Socjalistyczna (Australia)
Alternatywa Socjalistyczna (Australia)
Wolność Robotników (Australia)
Komunistyczna Partia Australii
Inicjatywa Marksistowska (Australia)
Partia Socjalistyczna (Australia)
Australijska Partia Kobiet
Partia Rozbrojenia Jądrowego (Australia)
*
Grupa "Stanowisko Robotników i Robotnic" (Austria)
Grupa Robocza "Marksizm" (Austria)
Iskra (Austria)
Rewolucyjna Liga Komunistyczna (Austria)
Sieć Pracy (Austria)
Komunistyczna Partia Austrii
Komunistyczna Partia Austrii
Socjalistyczna Partia Lewicy (Austria)
*
Organizacja Ludu Azańskiego
Ogólnoafrykański Kongres Azanii
Południowoafrykańska Partia Komunistyczna
Południowoafrykańska Partia Komunistyczna

Afrykański Komunista (RPA)




Umsebenzi (RPA)
AFRYKAŃSKI KONGRES NARODOWY (REPUBLIKA POŁUDNIOWEJ AFRYKI)
*
Zutik (Baskonia)
Solidarność Baskijska
Obywatele Baskijscy
Jedność Ludu (Baskonia)
Jedność Ludu (Baskonia)
Jedność Ludu (Baskonia)
Jedność Ludu (Baskonia)
Iparretarrak (Baskonia)
Baskijska Czerwona Sieć
*
Iskra/Jedność Socjalistyczna (Belgia)
Lewica Walcząca (Belgia)
Bojownik (Belgia)
Aktyw Studentów Lewicowych (Belgia)
*
Zgromadzenie na Rzecz Kultury i Demokracji (organizacja narodowowyzwoleńcza
Berberów)
*
Rewolucyjna Robotnicza Partia Mas (Boliwia)
Potęga Robotnicza (Boliwia)
Trockistowska Opozycja Boliwii
Trockistowska Opozycja Boliwii
Robotnicza Liga Rewolucyjna na Rzecz Czwartej Międzynarodówki (Boliwia)
Awangarda Socjalistyczna Boliwii
Oś Pacha Kuti (Boliwia)
*
Frakcja Trockistowska (Brazylia)
Lewicowy Ruch Socjalistyczny (Brazylia)
Tendencja na Rzecz Robotniczej Partii Rewolucyjnej (Brazylia)
So


• Re: :::©::: Data
|||c||| 22.06.02, 02:45 zarchiwizowany

|||c||| napisał(a):

Gość portalu: © napisał(a):
community.webshots.com/photo/4689543/39243966LIruwV

community.webshots.com/photo/10677669/41374265FzisvO



• Re: :::©::: Data
|||c||| 22.06.02, 02:42 zarchiwizowany

Gość portalu: © napisał(a):

community.webshots.com/photo/4689543/39243966LIruwV


• :::©::: Data IP: *.cm-upc.chello.se
Gość: © 22.06.02, 02:27 zarchiwizowany

www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=INFORMACJE&wid=2251949


• Re: śWięto Słońca 21.06.2002/5762/3760/1758 IP: *.cm-upc.chello.se
Gość: copy; 22.06.02, 00:40 zarchiwizowany

Gość portalu: _:_ napisał(a):

> zupagrzybowa napisał(a):
>
> .....................
> najkrotsza Noc w roku
> לóф
> _-:|:-__:-|-:__-:|:-__

©-©©©-©©©©©-©©©©©©-©©-©-©©-©©©-©©©-©-©©©©©©©-©©©©©©©-©-©©-©©©


• Re: śWięto Słońca 21.06.2002/5762/3760/1758 IP: *.cm-upc.chello.se
Gość: _:_ 21.06.02, 18:55 zarchiwizowany

zupagrzybowa napisał(a):

.....................
najkrotsza Noc w roku
לóф
_-:|:-__:-|-:__-:|:-__


• \/\/\\\\\/\//\/²©­®¥©¸¯\///²©//\ IP: *.cm-upc.chello.se
Gość: rvbar;›¤? 21.06.02, 02:36 zarchiwizowany

Gość portalu: /\\\/\/\ napisał(a):
³¥¬µ¬°²©­®¥©¸¯³·¨±µ¦¯ºª¶µ¥±µ¦´¶§µ¸©·º«¹¼ª´¸¦°¾©¶À«¸¾§»¹¢¶¸¡º»¤½·¥½º¨À¹©ÁºªÂ¶­¿¶­
¿¶ª¾³§»·¤¾¸¥¿¼¤Á¼¤Á¼¥¾º£¼½¥»¾¦¼½§¸¼¦·¸¤³¼¨·¸ª¶·©µµ©µ´¨´µ¨¸¸«»¶¦¹¶¦¹¸¦¹¸¦¹¾©½¼§»¼¥
¾»¤½¿¨Á¾§À¿¥º²˜­½£¸¾¤¹¹¤¸¹¤¸¹¤¸º¥¹¹¢»¸¡º·£»º¦¾·§ººª½¸¨»·§º»¤½»¤½¼¤¿»£¾·£Â·£Â´¢
Á² ¿³¡À´¢Á´£¿µ¤Àµ¥½´¤¼¸§¼º©¾·¨¸¶§·µ¥¸ªš­³ º´¡»´¡½±žºµ ºµ º³ž¸³ž¸°?·°
?·¯?µ³¡¹±?µ¯›³±Ÿ²² ³¯ ®­ž¬ªœ¨±£¯©˜¨¨—§©˜¨ª™©¦š¦¥™¥¥˜¡¦™¢«—¦¥‘ ¤?¡£? ¢“£¥–
¦ ’¥Ÿ‘¤¡?ª ?©ž‘¨¬Ÿ¶ ˜¥š’Ÿ™’?™’?œ’¡–Œ› “£Ÿ’¢
£“Ÿ£“Ÿ¢’ž¡‘??‘?ž’žš?’›?’›ž‘šŸ’› Ž˜?‹•?Œ”?Œ”š?’›‘“›‘“™?‘›ˆ•š‡”œŠ”?‹•˜ŽŽš??–
?‹”މ”މ–?‹•‘?–’Ž????????Ž‘‘?’”?‘“Œ”•Š”•Š˜™Œ•–‰˜—Šœ›Ž¢›“Ÿ˜? ™‘¡š’¢ —¡Ÿ–ŸŸ–ŸŸ–¤Ÿ—
¥ ˜£Ÿ• œ’ ?Ž ?Ž¡ž?£ ‘¥ž?¥ž?¦›?¢—Œ¢—Œ •Šž“ˆ •Šº¤“º¤“¸¤“¸¤“¶£–¶£–µ¡—¶¢
˜·Ÿš¶ž™µ¡™¸¤œµ¨–·ª˜³©–³©–·¦™¸§š¹¨›¹¨›¹¨›´£–«š?¸§š·¦™¶¥˜Ç³«¹¥?¸¡ ¸¡ ¶¡ ¸£¢
³¦›²¥š»±£·­Ÿ¼­ »¬Ÿ½«£½«£½¨§½¨§½¨§½¨§·ª¡»®¥º¯¦¹®¥¹¬¨¸«§¹¨«¹¨«»¥®¼¦¯¾¦¯¾¦¯À©¯¾§­
À¨±Á©²Ä©¹Á¦¶»¢²½¤´º¨­º¨­º¨­º¨­¾¤²»¡¯¿¥³À¦´Å®´· ¦Éµ¹¹¥©·¤¬¹¦®±Ÿ©·¥¯µ¨±´§°
¬§µ®©·™š±’“ªŽ’¯‘•²‹?¯‘“µ??°—šº ¦¼™Ÿµ?›ª–¡°Š›¤ŽŸ¨žª¶?›§…„›”“ª¯¦¾ —¯“‡›Ÿ“§­ °
´§··§³¶¦²·©°¸ª±¶­±²©­µ¬°¶­
±Å¶¿µ¦¯·§³¸¨´¶§µ¶§µ·¨¶¸©·»©³¹§±¼§´¾©¶¼¥¹¼¥¹º£¼º£¼¶¤¼¶¤¼³£»µ¥½²©»´«½¶ª¾¶ª¾º§Á»¨Â¿§
Ä»£À»¤½»¤½¼¤º¾¦¼½§¸»¥¶¸¤³»§¶¸ª¶¸ª¶¶ª¶¶ª¶µ¨¸µ¨¸µ¥¸µ¥¸º¨»º¨»¼§»¼§»¼¥¾»¤½¿¨Á¾§ÀÀ¦»¸ž
³¼¢·½£¸¹¤¸¹¤¸º¥¹¼§»º£¼¸¡º¸¤¼¹¥½·§º·§º¸¨»¶¦¹´?¶»¤½»£¾º¢½¶¢Á·£Â´¢Á´¢
Á³¡À³¡À¸§Ãµ¤À´¤¼³£»·¦»º©¾¶§·´¥µµ¥¸¶¦¹¶£½µ¢¼Ä±Í³ ¼µ º³ž¸³ž¸³ž¸°
?·¯œ¶¯?µ®œ´®š²±?µ² ³±Ÿ²®Ÿ­¬?«©›§¬žª¥”¤¨—§©˜¨«šª¥™¥¤˜¤¦™¢¥˜¡ª–¥¥‘ ¥‘¢¥‘¢¢“£
¢“£¡“¦¡“¦¡?ª¡?ª??§ž‘¨?•¢œ”¡›”Ÿ™’?œ’¡?“¢
Ÿ’¢ “££“Ÿ£“Ÿ ?œžŽššŽššŽšš?˜?’›?’›š?˜œ?˜œ?˜žŒ–?‹•§–žž?•“‰‹™?‘š?’™?‘š‡”š‡”šˆ’?‹•—
??˜ŽŽ™“Ž–?‹‘‹†’Œ‡•‘?•‘?‘‘‘’’’““‘““‘’”?‘“Œ”•Š”•Š™š?–—Š—–‰?œ?£œ”¡š’¡š’£œ”£¡˜£¡˜ŸŸ–
—š•?Ÿš’Ÿ›‘Ÿ›‘ ?Ž ?Žž›Œ¤¡’¨¡’¤?ޤ™Ž¢—Œ£˜?¢—
Œž“ˆœ‘†¶§•´¥“¶¥˜·¦™²ž›±?š&su


• śWięto Słońca 21.06.2002/5762/3760/1758
zupagrzybowa 20.06.02, 18:49 zarchiwizowany

.....................
najkrotsza Noc w roku
לóф


• .............................................13:33 IP: *.cm-upc.chello.se
Gość: 13:33 20.06.02, 13:34 zarchiwizowany

13:33


• Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se
Gość: den 20 j 20.06.02, 11:48 zarchiwizowany

den 20 juni 2002, 100650


• ||||||||||||||TSKZ|||||||||||||| IP: *.cm-upc.chello.se
Gość: |||||||| 17.06.02, 21:59 zarchiwizowany

www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=455804&aid=2199083
www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=455804&aid=2199119
www.gazeta.pl/alfa/home.jsp?dzial=0511&forum=SWIAT&wid=455804&aid=2199143


• Re: jpg IP: *.cm-upc.chello.se
Gość: |||||||| 17.06.02, 01:01 zarchiwizowany

www.fractal-vibes.com/fvc/fractals.html


• Re: Voice of Israel
pyza3 15.06.02, 17:56 zarchiwizowany

15.06.2002
"...po ten kwiat, po ten kwiat czerwony..."
"Czerwone maki na Monte Cassino...czerwone są, bo polską piły krew"
dymy nad Birkenau
NIGDY WIĘCEJ
niech nas Bóg ma w swojej opiece.


• Re: Voice of Israel IP: *.cm-upc.chello.se
Gość: |||||||| 15.06.02, 16:39 zarchiwizowany

aoo.freeservers.com/cgi-bin/i/images/aiz.gif


• U F O mania IP: *.cm-upc.chello.se
Gość: |||||||| 15.06.02, 01:44 zarchiwizowany

www.universe-people.com/


• |||||||||||||||||||||||||||||||||||||||||||||||||| IP: *.cm-upc.chello.se
Gość: |||||||| 13.06.02, 00:57 zarchiwizowany

How different it is today, even for the direct descendents of those highly
sexual people of ancient times. Modern Western culture has nearly wiped out
this powerful sexual knowledge.

Diligent and dedicated sex researchers have successfully re-discovered the
Lost Pleasure Secrets of the Ancient Orient. Now you can experience the
ultimate in erotic passion and pleasure with Za-Zen.

This beautifully illustrated web site uncovers simple, yet powerful,
techniques which anyone can enjoy:

For Men:
Remove forever any thought of impotence, premature ejaculation, lack of
arousal, failure to orgasm. Teach Za-Zen to your lover and NEVER beg for sex
again!

For Women:
Remove forever any thought of vaginal pain, lack of lubrication, lack of
sexual desire, failure to orgasm, faking orgasm and guilt or shame after sex.
Za-Zen removes all dread of sex from your life FOREVER!

For Men and Women:
1. Use sex as a means to empower and energize the body. Fully enjoy sex even
when you are tired. You will have more energy after Za-Zen and feel totally
satisfied.
2. Achieve and maintain the high level of arousal necessary to experience
multiple, intense orgasms without exercising, drugs or tonics.
3. Try the PERFECT sex position for all body sizes and shapes. Maintain
control, arousal and comfort for hours if you want to...

The powerful secrets of Za-Zen will change your love life FOREVER!

www.zazensex.com/adults/
www.zazensex.com/adults/waterdiva.gif
www.zazensex.com/adults/spinyang.gif


• Re: //\/\/\\\\\/\//\/\/////\\\/////\\/\/\/\///\\\/\\/\ IP: *.cm-upc.chello.se
Gość: /\\\/\/\ 10.06.02, 19:09 zarchiwizowany

www.gazeta.pl/ads/628/TBGGFUIJDZTYUVPACQOPKMAAPCYBGA.gif


• ...........obrazki ze stalinem... retrospekcja IP: *.cm-upc.chello.se
Gość: drF 10.06.02, 18:31 zarchiwizowany

www.stel.ru/stalin/images/1935-february400.jpg
www.stel.ru/stalin/images/1935-february2400.jpg
www.stel.ru/stalin/images/1935-december400.jpg
www.stel.ru/stalin/images/1936_march400.jpg
www.stel.ru/stalin/images/1937_april400.jpg
www.stel.ru/stalin/images/1937_november400.jpg
www.stel.ru/stalin/images/1937_november2-mausoleum400.jpg
www.stel.ru/stalin/images/1938-august400.jpg
www.stel.ru/stalin/images/1938-january400.jpg
www.stel.ru/stalin/images/1939-2-plakat400.jpg
www.stel.ru/stalin/images/1939-august-paktGermany3400.jpg
www.stel.ru/stalin/images/1939-august-paktGermany400.jpg
www.stel.ru/stalin/images/1940-november_Molotov_and_Hitler400.jpg
neptune.spaceports.com/~stalin/Stalin_speech.ram
stalin.narod.ru/
Joseph Stalin had been leader of the Soviet Union for nearly 30 years. Though
he is now considered responsible for the deaths of millions of his own people
through famine and purges, when his death was announced to the people of the
Soviet Union on March 6, 1953, many wept. He had led them to victory in World
War II. He had been their leader, the Father of the Peoples, the Supreme
Commander, the Generalissimo.



Stalin and Zhukov at the Lenin mausoleum tribune

And now he was dead.

Through a succession of bulletins, the Soviet people had been made aware that
Stalin was gravely ill. At four in the morning of March 6, 1953, it was
announced: "The heart of the comrade-in-arms and continuer of genius of
Lenin's cause, of the wise leader and teacher of the Communist Party and the
Soviet Union, has ceased to beat."

Joseph Stalin, 73 years of age, had suffered a cerebral hemorrhage and died at
9:50 p.m. on March 5, 1953.

Stalin's body was washed by a nurse and then carried via a white car to the
Kremlin mortuary. There, an autopsy was performed. After the autopsy was
completed, Stalin's body was given to the embalmers to prepare it for the
three days it would lay-in-state.



Stalin's body was placed on temporary display in the Hall of Columns.



Thousands of people lined up in the snow to see it. The crowds were so dense
and chaotic outside that some people were trampled underfoot, others rammed
against traffic lights, and some others choked to death. It is estimated that
500 people lost their lives while trying to get a glimpse of Stalin's corpse.



On March 9, nine pallbearers carried the coffin from the Hall of Columns onto
a gun carriage.



The body was then ceremoniously taken to Lenin's tomb on the Red Square in
Moscow.

Only three speeches were made - one by Georgy Malenkov, another by Lavrenty
Beria, and the third by Vyacheslav Molotov. Then, covered in black and red
silk, Stalin's coffin was carried into the tomb. At noon, throughout the
Soviet Union, came a loud roar - whistles, bells, guns, and sirens were blown
in honor of Stalin.

Stalin`s and Lenin`s bodies in Lenin mausoleum
Removing Stalin`s body
Stalin Biography
Stalin Video
Stalin on Lenin: audio and texts

-------------------------------------------------------------------------------
stalin.narod.ru/images/CPSU_at_lenin_mausoleum.jpg


• -----------------------troche o niczym----------- IP: *.cm-upc.chello.se
Gość: ________ 10.06.02, 00:28 zarchiwizowany

Trans-Portals: Energy Gates in Time and Space
-------------------------------------------------------------------------------
http://www.spiritweb.org/Spirit/healing.html

written by Daniel Jacob (daniel@reconnections.net)
Posted Mon, 12-Nov-2001 09:07:37 GMT
Daniel Jacob

Daniel Jacob is a Writer, a Bio-Energetic Bodyworker, and a Conscious Channel,
living in the Greater Seattle area of the U.S. He owns and operates a Multi-
Therapist Rehab Clinic, on the Eastside of Lake Washington, specializing in
the treatment of trauma injury, chronic stress, and the usage of physical and
spiritual processes which support personal recovery and expansion. In 1995, he
organized the Worldwide Transmutation Network on the Web, and currently
conducts global research and education concerning Earth changes, as well as
the physical and emotional ramifications of Planetary Ascension.
More articles by Daniel Jacob, visit http://www.reconnections.net/.


Current Articles:



June, 2002

Changes of SpiritWeb - Rene K. Mueller
May, 2002

Tune up your Chakras & Shift into Higher Love - Cynthia Sue Larson
Developing Your Own Personal Ray of God Light - Ronna Herman
Deep is Your Self Love - Jim Malloy
Love Is A State of Being - Ronna Herman
April, 2002

Trans-Portals 3: Building Astral Bridges - Daniel Jacob
The Compass - Abby Haydon
Living in an Alpha World - Ronna Herman
UFC 04/02: Universal Festival Calendar for April, 2002 - Dan Furst
A New Operating System - Wistancia Stone
Journey To Sacred Union - Suzanna Kennedy
As Time Goes Bye - Wistancia Stone
March, 2002

Beyond Human Boundaries - Daniel Jacob
The Cyberspace Genie - Christan Hummel
UFC 03/02: Universal Festival Calendar for March, 2002 - Dan Furst
Harnessing The Power of Creation - Ronna Herman
February, 2002

Higher Guidance - It's closer than you may think - Jim Malloy
Open-Heart Mergery - Daniel Jacob
UFC 02/02: Universal Festival Calendar for February, 2002 - Dan Furst
The Return Of Father Earth's Spirit - Ronna Herman
January, 2002

Identification - The Essence of Meditation - Dinu Roman
Heartful Mind & Mindful Heart - Dinu Roman
Finishing Off One Reality and Moving Multidimensionally ... - Wistancia Stone
Catching the Harmony - or - Trains, Time Lines and Circles - Wistancia Stone
Trans-Portals 2: Travel Within the Multiverse - Daniel Jacob
Will You Be Among The Chosen? - Ronna Herman
December, 2001

UFC 01/02: Universal Festival Calendar for January, 2002 - Dan Furst
Obtain the Note of Modern Day Mastery - JUST DO IT! - Lisa J. Smith
Even older articles:

November, 2001
October, 2001
September, 2001
August, 2001
July, 2001
June, 2001
May, 2001
April, 2001
March, 2001
February, 2001
January, 2001

Year 2001
Year 2000
Year 1999
Year 1998
Year 1997
Year 1996
Year 1995
Year 1994
Year 1993
Year 1992
Year 1991



Another Transmission from The Reconnections . . . . . . .


TRANS-PORTALS: Energy Gates in Time and Space


My Dear Friends,

We greet you, on this bright 11/11/01 . . . . . . . . . and celebrate 10 years
of work through this physical channel by weaving together some key concepts ---
relevant in days past, but never so crucial as in the next 10 years that lie
ahead for humankind. Those keynote events, which recently awakened your planet
to faith and to action, have torn away the last veils of denial from the
Collective Consciousness. A stone has been thrown into the water, and ripples
of pure energy now spread around the globe --- ushering in what will
eventually become known as The Age of Conscious Choice. Doorways are opening,
and magic is afoot! And we are here to explain, in detail, how they work and
what they mean. This is no longer a game to be played by just the spiritual
elite. What was once a privilege of the chosen few now becomes the heritage of
all.

All around you, in every place, there exist Energy Gates --- portals in time
and space --- through which a person can pass to new life and experiences.
Some are visible, and some are merely etheric. All of them are real. Some
portals exist as specific places. Simply to visit these locations is to be
transformed. Other portals require energetic "passwords" or "vibrational
signatures" to activate them. Still others --- those connected to the highest
levels of transformation --- require the usual passwords, along
with "sponsorship" by an Etheric Guide, so that the unconscious or unprepared
can not enter them unaware.

There are many kinds of Trans-Portals. Most are opened through the
verbalization of some goal or desire for personal development. In such cases,
the INTENT of the traveler becomes a blade that cuts an opening in the Veil
which divides your universes. Once a portal is opened, the journey begins. A
vortex draws the individual in, and certain "changes" are effected, so that
transport to an adjacent universe can occur.


JOURNEYS THROUGH TIME AND SPACE


Transformation begins with two elements: disorder and disintegration. When a
physical body passes through a portal, it begins to be broken down into basic
elements that can be transported easily within the Multiverse. Once a decision
is made, this process is usually so rapid that it is barely noticeable. The
human mind has a tremendous filtration ability, and has a habit of editing out
all knowledge concerning what we are describing here. The mind's power to knit
together universes, into a logical sequence, gives a person the impression
that reality is one continuous landscape, rather than the infinite collation
of alternative possibilities which it can be.

The arrival of disorder ("chaos energy") into any organized structure produces
CONFUSION. If you examine this word, you will see that it is composed
of "con," which means "against" and "fusion," that which binds physical
material together. To become con-fused means to LIFT OFF from your current
orientation, in the same way a rocket ship launches itself, and moves towards
something new.

Confusion scrambles the mind. It mixes and mingles old orientations, to clear
the way for new ones. Its physical counterpart is CONSUMPTION. When a Trans-
Portal is entered, the energy acceleration actually consumes the physical
body. Once the traveler arrives at his new destination, the original INTENT
manifests, and downsteps itself into an appropriate physical vehicle. We will
speak more of consumption later. There are important lessons to be learned
there.

Once a person has arrived at a destination point, his mind is free to concoct
any number of rationalizations to explain why and how he is there, rather than
where he was. Sometimes, it will appear as though he awakens from sleep, only
to assume that he must have been dreaming. At other times, he will tell
himself that he has experienced "time loss" during a car trip, or while
working in the back yard. And in some cases, the shift is so drastic, and the
internal weaving of universes so pristine, that the individual never realizes
he has moved at all.

You would be quite surprised to know how many fantastic journeys you have
taken --- only to file them, forget about them, and resume working at some
mundane task . . . . . . .as though nothing had happened to you. Rest assured,
your "travel photos" are all kept safe and available, waiting for the time
when you will review and enjoy them again . . . . . . .a time that is rapidly
approaching, by the way!


ENERGY GATES


What is an Energy Gate? Basically, it is the intersection of desire and
opportunity --- wherein the signature vibration of a person synchronizes
itself with physical conditions to produce a change or an effect. Another
expression that has often been used to describe it is "a window of
opportunity."

Energy Gates, them


• ........................................... IP: *.cm-upc.chello.se
Gość: ........ 04.06.02, 20:30 zarchiwizowany

www.odci.gov/cia/publications/factbook/geos/pl.html


• ............................................Primes IP: *.cm-upc.chello.se
Gość: 101 03.06.02, 20:30 zarchiwizowany

www.geocities.com/~harveyh/primes.htm#PRIME%20is%20Prime_

______________________________________________________________________________


www.geocities.com/~harveyh/Image_No/Cershen.gif

In this pattern the sum of each pair of numbers connected by a line sums to a
prime number.
The pattern is symmetrical both horizontally and vertically and uses the
consecutive numbers from 1 to 22.

JRM 26-1, pp71 solution by Eryk Cershen of Redwood City, California; from a
problem suggested by Brian Barwell of Middlesex, England
___________________________________________________________________________

www.geocities.com/~harveyh/Image_No/PrimCube.gif

The only arrangement of 8 consecutive digits (not counting rotations or
reflections) such that any two adjacent sum to a prime number.
_______________________________________________________________________________

www.geocities.com/~harveyh/Image_No/CP19937.gif

A circular prime is a prime number that remains prime as each leftmost digit
(msd)
in turn is moved to the right hand side.

From Patrick De Geest's Palindrome numbers WWW site (see above)
______________________________________________________________________________

www.geocities.com/~harveyh/Image_No/P_Pair_P.gif
Digital sums of prime pair products
___________________________________________________________________________



• Urban a Europa... IP: *.cm-upc.chello.se
Gość: ________ 02.06.02, 22:50 zarchiwizowany



Eurojazgot

Polska przestanie być żałobną matroną po przejściach, Matką Boleściwą przez
wieki gwałconą przez wielkich brutali z sąsiedztwa. Ma przybrać postać złotej
gwiazdki na granatowym niebie późnego zachodu. Wszystko, co infantylne, od
przedszkolaków po generałów, kocha gwiazdki. Dorosłym mdło już się jednak robi
od ich nadmiaru w naszym telewizyjnym polu widzenia świata.

Z Europą Zachodnią zaczęliśmy się łączyć w stylu ściśle azjatyckim. Bębny,
piszczałki, manifestacje, pochody, chorągwie, frazesy. Unia Europejska już
stała się natręctwem. Siódmego dnia, gdy nawet niezmordowany Bóg odpoczął,
telewizor publiczny wali w nas w kółko nabożeństwami unijnymi na przemian z
katolickimi. Po to, żeby Polak-katolik w swej podświadomości mrocznej zespolił
obrządki stary i nowy, więc powziął pewność, że gwiazdy unijne spłynęły wprost
z błękitnego płaszcza Matki Boskiej i wymagają podobnie rzewnego kultu. "Kto
ty jesteś? Europejczyk mały". Miłosz to zrymuje.

Dla mas – hałas propagandy totalnej. Elita odsyłana jest do Internetu po paszę
treściwą. Pojawiła się bratnia wobec sukienkowych Glempa nowa kasta kapłańska:
kapłanów unijnych. Agitka proeuropejska daje premierowi pretekst, żeby
w "Wiadomościach" pokazywać się narodkowi po trzy razy zamiast dwóch,
Oleksemu, żeby nie dać o sobie zapomnieć, Wiatrowi, żeby dąć, innym, aby
zaistnieć i zarobić. Stary wypróbowany sposób tworzenia kultu – po uszach, po
oczach i bez wytchnienia – ciągle jest równie dobry jak za Stalina. Na pewno
po roku presja unijna zwiększy liczbę odruchowo głosujących za Unią. Wątpię
jednak, czy wpłynie na frekwencję. Wzrośnie liczba ludzi tak Unią wymęczonych,
że nie zbiorą sił, żeby pójść głosować w referendum. Dojrzeje też odwieczny
owoc przesytu – przekora młodzieży.

Prounijny jazgot przepędza z Polski nastrój chłodnej rzeczowości i
sceptycznego luzu. Czyż nie jest paradoksem taki rozziew między celem a
środkami, które do niego wiodą?

Kapłani europejskiego obrządku głoszenie katechizmu rozpoczęli od zapewnień,
że członkostwo Polski w Unii ani o piździ włos nie nadweręży naszej ukochanej
kapuściano-kartoflanej suwerenności. Czyż Niemcy – mówią – przestali być
Niemcami, a Francja Francją. Chciałoby się odpowiedzieć, że w Związku
Radzieckim Rosja nie przestała być Rosją, ale Litwa – Litwą poniekąd. Bo też
prounijna propaganda totalna tchórzem jest podszyta. Któż ośmieli się
wstrząsnąć nacjonalistycznym atawizmem Polaków i sprowadzić ich ze
strof "Roty" ku realiom zglobalizowanego świata? Powiedzmy wprost, że Polska
jako gospodarczy, kulturalny, militarny i polityczny pyłek nie jest, a tym
bardziej w przyszłości nie może być suwerenna. Suwerenność, jak i husaria, to
byt z innej epoki. Jej poszerzanie było racjonalnym odśrodkowym celem PRL w
czasach Układu Warszawskiego. Teraz zaś cele są odwrotne – dośrodkowe wobec
Zachodu.
Akces Polski i reszty krajów Europy Wschodniej (czyli rzekomo Środkowej) do
Unii zwiększy za to zakres suwerenności całej Europy, która i tak staje się
przedmieściem cywilizacji globalnej.

Nie ma w Polsce mężów stanu, którzy próbowaliby przemeblować mózgi nasączone
powstańczymi mitami niepodległościowymi i wódką z piwem. Do Unii kolebiemy się
karmieni kłamstwami przypochlebnymi wobec tradycyjnych wyobrażeń typu "nie
rzucim ziemi". Propaganda zniża się do poziomu odbiorców nie próbując
wyciągnąć ich z obrębu patriotycznej bezmyślności deklamacyjnej.

Niesiemy do Unii myśl i praktykę polityczną lotną jak jamnik. Tylko dwa tego
przykłady, obydwa z zakresu polskiej polityki wschodniej – jedynej dziedziny,
w której Zachód, choćby ze względu na polityczne dzieje PRL, uznać mógłby
naszą kompetencję. Gdybyśmy tylko potrafili ją okazać.

Problem okręgu kaliningradzkiego – rosyjskiej enklawy w przyszłym obszarze
unijnym. Polska wciąż skrzeczy: nie pozwolimy Rosji pociągnąć eksterytorialnej
autostrady. Powód: eksterytorialna autostrada źle nam się historycznie
kojarzy. Mamy więc wciąż politykę historycznych skojarzeń narodowych, fobii,
uspokajania ojca Rydzyka i Antoniego Macierewicza. Czyli prymat motywów
wewnątrzpolskich nad europejskimi. Zadaniem dla polskiej myśli politycznej
byłoby natomiast stworzenie projektu podwójnej, czyli korzystnej dla nas
integracji Kaliningradu z Rosją i z Zachodem. Projektu, który by wyrażał
interes Rosji, Polski i Unii Europejskiej zarazem. Zamiast tego non possumus
splecione z no pasarán.

Drugi przykład. Strategicznym, historycznym, nadrzędnym, złotym, politycznym,
gospodarczym, militarnym interesem Polski jest sojusz z Ukrainą. Jedyny zaś
bieżący przejaw polityki polskiej wobec Kijowa to idiotyczny, dziecinnie
uparty spór Warszawy o lwowskie imponderabilia. Niedorozwinięte stosunki
ukraińsko-polskie skaziła kłótnia o treść jednej głupiej, nieważnej tablicy
cmentarnej we Lwowie. Sentymenty tradycjonalistów-nacjonalistów, wymierających
dinozaurów kresowych realnie górują nad racją stanu RP.

Sam Kwaśniewski wije się jak piskorz jako mąż stanu i nie mąż. Nie ma
zdecydowania i odwagi, by rąbnąć pięścią w stół: do kurwy nędzy, Niemcy nam
wzorem! Czy rzeźbią oni w Polsce tablice drażniące narodowe urazy tubylców?
Lwów jest i będzie ukraiński, więc tylko durny sąsiad Ukrainy może tam chcieć
sławić dawnych bojowników sprawy od 60 lat przegranej na zawsze. Co i chwała
Bogu. Sławienie bojowników o Polski Lwów nadweręża stabilność granic w
Europie – podstawy jej zjednoczenia, a też fundamentu istnienia Polski z jej
granicami na zachodzie. Polityka polska już nigdy nie powinna się potykać o
żadne kamienne tablice.

Zręczna elastyczność Kwaśniewskiego dać mu może z czasem 90 proc. społecznego
poparcia, ale nie osiągnie on ani 5 proc. wielkości stroniąc od pokazywania
takiej twardości jak w Jedwabnem. Nie stać jednak polskich przywódców na
politykę prawdziwie zaświadczającą o ich europejskiej mentalności. Zamiast
tego transparenty, gwiazdki, orkiestry, Miller w uściskach ze Schroederem,
Kwaśniewski z Chirakiem i papież, ten świątek narodowy, zamiast różańca
przebierający trzęsącą się łapą gwiazdki europejskie na kolażach unijnych w
telewizji Kwiatkowskiego.

Ani śladu kampanii boleśnie przeorującej zakrzepły w innej epoce,
anachroniczny polski patriotyzm. Unię Europejską wystawia się jako obiekt
kolejnego w tym kraju kultu. Zamiast morderczej polemiki z formacją
radiomaryjną – zamazywanie kontrastów w imię jednoczenia społeczeństwa na
kompromisowym poziomie. Czyli powyżej bagna nacjonalizmu, ale jeszcze w jego
oparach. Łeb Oleksego, serce Rydzyka – oto Polak
łapiący gwiazdy złote.

Autor : Urban


• .................................www.aquanet.co.il IP: *.cm-upc.chello.se
Gość: ________ 27.05.02, 22:46 zarchiwizowany

www.aquanet.co.il/war2002/34.html


• __________________________________________________ IP: *.cm-upc.chello.se
Gość: ________ 27.05.02, 21:40 zarchiwizowany

_______________________________________________ops


• //\/\/\\\\\/\//\/\/////\\\/////\\/\/\/\///\\\/\\/\
alef1 22.05.02, 01:34 zarchiwizowany

yoyo.cc.monash.edu.au/~bunyip/primes/index.html


• Re: {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}}}}}}}
zupagrzybowa 22.05.02, 00:29 zarchiwizowany

nie ma sie co bac
www.conspiratorium.20m.com/confire3.gif
wszystko bendzie dobrze
pzdr in coguto


• Re: {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}}}}}}}
wild2 21.05.02, 21:35 zarchiwizowany

Panie Dochtórze F :))) (z całym nalerznim szacónkiem) :))
Funfel wreście zobacził.... i siem tak straaasznie przestrasził... łuj, rze asz
blądina prziszła z tim zatrzikiem... łoj, łoj... ale strasznie biło.... usch !
Aż my siem tyż wystraszyli :(


• Re: : ((((((-....AA.....-)))))) :
wild2 21.05.02, 17:14 zarchiwizowany

Dzienkujem, Panie Dr F :))
Ja to "aaaa" funflowi beściakowi pokazał, ale łun nie rozumie po
zagramanicznemu :((
Blądina tyż niegramotna, a niby terapiem nam miała robić :((
A ten apsolót art co pan dochtór wysłał, to już wogule nie dla nasz na
oddziale ;) Tilko nam kąputri zostali coby siem wyleczyć.....
Zdruuuffko anyłej :))


• {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}}}}}}} IP: *.cm-upc.chello.se
Gość: drF 19.05.02, 22:10 zarchiwizowany

www.lewman.com/images/www.attrition.org/gallery/spoof/Impotenc.jpg
www.dadaland.com/gifs/absolut.gif
www.adlerandco.com/britto/images/absolutII.gif
www.dadaland.com/absolut.html
www.ealowbw.dabsol.co.uk/Systems/Zero/Zero.htm
__________________________________________________________

pz dr F


• : ((((((-....AA.....-)))))) : IP: *.cm-upc.chello.se
Gość: drF 19.05.02, 21:57 zarchiwizowany

Nykterismens Höga Visa
_________________________________________________________
http://www.alcoholics-anonymous.org/
Alcoholism and Alcoholics

Not too long ago, alcoholism was viewed as a moral problem. Today, many regard
it primarily as a health problem. To each problem drinker, it will always
remain an intensely personal matter. Alcoholics who approach A.A. frequently
ask questions that apply to their own experience, their own fears, and their
own hopes for a better way of life.


What is alcoholism?

There are many different ideas about what alcoholism really is.

The explanation that seems to make sense to most A.A. members is that
alcoholism is an illness, a progressive illness, which can never be cured but
which, like some other diseases, can be arrested. Going one step further, many
A.A.s feel that the illness represents the combination of a physical
sensitivity to alcohol and a mental obsession with drinking, which, regardless
of consequences, cannot be broken by willpower alone.

Before they are exposed to A.A., many alcoholics who are unable to stop
drinking think of themselves as morally weak or, possibly, mentally unbalanced.
The A.A. concept is that alcoholics are sick people who can recover if they
will follow a simple program that has proved successful for more than one and a
half million men and women.

Once alcoholism has set in, there is nothing morally wrong about being ill. At
this stage, free will is not involved, because the sufferer has lost the power
of choice over alcohol. The important thing is to face the facts of one's
illness and to take advantage of the help that is available. There must also be
a desire to get well. Experience shows that the A.A. program will work for all
alcoholics who are sincere in their efforts to stop drinking; it usually will
not work for those not absolutely certain that they want to stop.


How can I tell if I am really an alcoholic?

Only you can make that decision. Many who are now in A.A. have previously been
told that they were not alcoholics, that all they needed was more willpower, a
change of scenery, more rest, or a few new hobbies in order to straighten out.
These same people finally turned to A.A. because they felt, deep down inside,
that alcohol had them licked and that they were ready to try anything that
would free them from the compulsion to drink.

Some of these men and women went through terrifying experiences with alcohol
before they were ready to admit that alcohol was not for them. They became
derelicts, stole, lied, cheated, and even killed while they were drinking. They
took advantage of their employers and abused their families. They were
completely unreliable in their relations with others. They wasted their
material, mental, and spiritual assets.

Many others with far less tragic records have turned to A.A., too. They have
never been jailed or hospitalized. Their too-heavy drinking may not have been
noticed by their closest relatives and friends. But they knew enough about
alcoholism as a progressive illness to scare them. They joined A.A. before they
had paid too heavy a price.

There is a saying in A.A. that there is no such thing as being a little bit
alcoholic. Either you are, or you are not. And only the individual involved can
say whether or not alcohol has become an unmanageable problem.


Can an alcoholic ever drink 'normally' again?

So far as can be determined, no one who has become an alcoholic has ever ceased
to be an alcoholic. The mere fact of abstaining from alcohol for months or even
years has never qualified an alcoholic to drink "normally" or socially. Once
the individual has crossed the borderline from heavy drinking to irresponsible
alcoholic drinking, there seems to be no retreat. Few alcoholics deliberately
try to drink themselves into trouble, but trouble seems to be the inevitable
consequence of an alcoholic's drinking. After quitting for a period, the
alcoholic may feel it is safe to try a few beers or a few glasses of light
wine. This can mislead the person into drinking only with meals. But it is not
too long before the alcoholic is back in the old pattern of too-heavy drinking —
in spite of all efforts to set limits for only moderate, social drinking.

The answer, based on A.A. experience, is that if you are an alcoholic, you will
never be able to control your drinking for any length of time. That leaves two
paths open: to let your drinking become worse and worse with all the damaging
results that follow, or to quit completely and to develop a new pattern of
sober, constructive living.


Can't an A.A. member drink even beer?

There are, of course, no musts in A.A., and no one checks up on members to
determine whether or not they are drinking anything. The answer to this
question is that if a person is an alcoholic, touching alcohol in any form
cannot be risked. Alcohol is alcohol whether it is found in a martini, a Scotch
and soda, a bourbon and branch water, a glass of champagne — or a short beer.
For the alcoholic, one drink of alcohol in any form is likely to be too much,
and twenty drinks are not enough.

To be sure of sobriety, alcoholics simply have to stay away from alcohol,
regardless of the quantity, mixture, or concentration they may think they can
control.

Obviously, few persons are going to get drunk on one or two bottles of beer.
The alcoholic knows this as well as the next person. But alcoholics may
convince themselves that they are simply going to take two or three beers and
then quit for the day. Occasionally, they may actually follow this program for
a number of days or weeks, Eventually, they decide that as long as they are
drinking, they may as well "do a good job." So they increase their consumption
of beer or wine. Or they switch to hard liquor. And again, they are back where
they started.


I can stay sober quite a while
between binges; how can I tell
whether I need A.A.?

Most A.A.s will say that it's how you drink, not how often, that determines
whether or not you are an alcoholic. Many problem drinkers can go weeks,
months, and occasionally years between their bouts with liquor. During their
periods of sobriety, they may not give alcohol a second thought. Without mental
or emotional effort, they are able to take it or leave it alone, and they
prefer to leave it alone.

Then, for some unaccountable reason, or for no reason at all, they go off on a
first-class binge. They neglect job, family, and other civic and social
responsibilities. The spree may last a single night, or it may be prolonged for
days or weeks. When it is over, the drinker is usually weak and remorseful,
determined never to let it happen again. But it does happen again.

This type of "periodic" drinking is baffling, not only to those around the
drinker, but also to the person still drinking. He or she cannot understand why
there should be so little interest in alcohol during the periods between
binges, or so little control over it once the drinking starts.

The periodic drinker may or may not be an alcoholic. But if drinking has become
unmanageable and if the periods between binges are becoming shorter, chances
are the time has come to face up to the problem. If the person is ready to
admit to being an alcoholic, then the first step has been taken toward the
continuing sobriety enjoyed by thousands upon thousands of A.A.s.


Others say I am not an alcoholic. But my
drinking seems to be getting worse.
Should I join A.A.?

Many members of A.A., during their drinking days, were assured by relatives,
friends, and doctors that they were not alcoholics. The alcoholic usually adds
to the problem by an unwillingness to realistically face the facts of drinking.
By not being completely honest, the problem drinke


• Re: .......................INCOGNITO ERGO SUM ?
wild2 19.05.02, 21:18 zarchiwizowany

I DK är sprit-passande ålder på 15 år :)))
Thx God, så att till och med lilla mig får lov att handla nåt ;))


• Re: ((((((-....SystemBolaget.........-)))))))
wild2 19.05.02, 21:15 zarchiwizowany

Det är faan mig MYCKET billigare i Danmark :)))
Du gamla, du fria och *mycket dyra* Nord, heheheheehhee
Nieustajonce pozdro ;))
från en OCKSÅ wild en (eller två eller??? siostro!!!)


• .......................INCOGNITO ERGO SUM ? IP: *.cm-upc.chello.se
Gość: dRF 19.05.02, 21:13 zarchiwizowany

wild2 napisał(a):

> zupagrzybowa napisał(a):
>
> > Önskar dettsamma
> > Vi hörs...
> > drf inCog(n)ito
> U nasz na oddziale to mówiom "In Koguto" ;))
> Med vänlig hälsning
> Wild2 - Cogito Ergo Sum :))
______________________________________________________
Reasons for a monopoly
The reasons are related to decisions made in an effort to minimize the harm
resulting from alcohol consumption. It is our belief that limiting private profit
based on alcohol sales will help reduce overall consumption.

The idea is not a new one. Our experience of this system dates back to 1865, when
Systembolaget’s first predecessor was established. It was founded because the
average alcohol consumption of 46 liters of spirits a year per inhabitant had an
undesirable effect on society. Working capacity decreased, as work-related
accidents increased, and output declined. The conclusion was that as long as
there was unlimited access to inexpensive alcohol, provided by private retailers,
it would be hard to decrease overall consumption.


Social responsibility
Something had to be done, and the initiative was taken by several mine owners in
the Dalecarlia province in northern Sweden. They introduced a system for selling
alcohol with profits going back into the community, rather than to private
interests. After this, the system was soon introduced nationwide. This system,
combining alcohol sales with social responsibility, proved to be an effective
instrument for reducing alcohol consumption in Sweden.

This sense of social responsibility is the foundation on which Systembolaget and
its activities still are built. We provide Swedish customers with alcoholic
beverages, but our sense of responsibility brings about other ways of presenting
our products to our customers than a private profit-seeking enterprise would use.

We do not encourage people to consume alcoholic beverages. Neither do we support
nor actively market any individual brand or engage in sales promotion. Of course
this does not prevent the staff from giving good advice when it comes to
selecting a certain beverage to go with a given kind of food. But they will never
try to persuade people into buying more than they initially intended.


Early drinking habits
The social responsibility is especially significant when it comes to young
people, defined in this case as anyone under the age of twenty, according to the
Swedish Alcohol Act. Research has shown that the earlier people start to drink,
the more likely they are to become alcoholics later on. We also know that young
bodies suffer greater harm from alcohol.

A common opinion, especially among young people, is that the minimum purchase age
should be lowered to 18. By doing so, we would not only give access to alcohol
among 18 and 19 year olds, but also youngsters below this age would gain easy
access to wines and spirits, since their older friends would be likely to supply
them.

Systembolaget also supplies information about the hazards of drinking, and
cooperates with several organizations to alleviate the more risky sides of
alcohol.


A wide product range
Naturally, regardless of every good intention, our methods will be criticized by
those who want a less limited access to alcoholic drinks in Sweden. One of the
more frequent arguments for closing down the monopoly is that it would expand the
number of items offered. However, contrary to what many believe, in this case
monopoly widens, rather than restricts, product range. Few private retailers
could afford – or even have room for – the kind of stock we offer.

www.systembolaget.se/english/xindex.htm

--------------------------------------------------------------------------------

םזגרם'ןקמןש
вкА
δΡφ
dRf


• Re: ((((((-....SystemBolaget.........-)))))))
wild2 19.05.02, 21:10 zarchiwizowany

Gość portalu: DrF napisał(a):


>
> www.systembolaget.se/
>
>
> BRÄNNVIN, okryddat
> Artikel med blåmarkerat pris finns i samtliga butiker
>
> Varunamn Årg Varunr Land Volym Pris Kr / liter
> 32 Brännvin
> 231 Sverige 700ml 165.00 kr ( 235.71)
> 350ml 94.00 kr ( 268.57)
> 38 Brännvin
> 204 Sverige 700ml 194.00 kr ( 277.14)
> 350ml 103.00 kr ( 294.29)
> 60 Brännvin
> 286 Sverige 700ml 314.00 kr ( 448.57)
> Absolut Vodka
> 88 Sverige 700ml 229.00 kr ( 327.14)
> 350ml 126.00 kr ( 360.00)
> 600ml 228.00 kr ( 380.00)
> Brännvin Special
> 158 Sverige 700ml 169.00 kr ( 241.43)
> 350ml 95.00 kr ( 271.43)
> Dufvenkrooks Vodka
> 62 Sverige 700ml 192.00 kr ( 274.29)
> Explorer Vodka
> 3 Sverige 700ml 198.00 kr ( 282.86)
> 350ml 105.00 kr ( 300.00)
> Finlandia
> 63 Finland 700ml 228.00 kr ( 325.71)
> 350ml 119.00 kr ( 340.00)
> 600ml 223.00 kr ( 371.67)
> Koskenkorva
> 53 Finland 700ml 199.00 kr ( 284.29)
> 350ml 104.00 kr ( 297.14)
> Koskenkorva Viina
> 233 Finland 700ml 195.00 kr ( 278.57)
> Kronvodka
> 4 Sverige 700ml 210.00 kr ( 300.00)
> 350ml 113.00 kr ( 322.86)
> Moskovskaya
> 32 Ryssland 700ml 209.00 kr ( 298.57)
> Patron Vodka
> 11 Tyskland 700ml 194.00 kr ( 277.14)
> Renat Brännvin
> 1 Sverige 700ml 204.00 kr ( 291.43)
> 350ml 108.00 kr ( 308.57)
> 500ml 169.00 kr ( 338.00)
> Seriously Vodka
> 47 Sverige 700ml 231.00 kr ( 330.00)
> Skyy Vodka
> 61 USA 700ml 229.00 kr ( 327.14)
> 600ml 229.00 kr ( 381.67)
> Smirnoff
> 108 Storbritannien 700ml 224.00 kr ( 320.00)
> 500ml 199.00 kr ( 398.00)
> 350ml 118.00 kr ( 337.14)
> Stolichnaya Cristall
> 77 Ryssland 700ml 249.00 kr ( 355.71)
> Stolichnaya Vodka
> 91 Ryssland 700ml 229.00 kr ( 327.14)
> Svensk Vodka Lake Vättern
> 5 Sverige 700ml 209.00 kr ( 298.57)
> 500ml 180.00 kr ( 360.00)
> Svenskt Brännvin 1467
> 234 Sverige 700ml 229.00 kr ( 327.14)
> Thors Hammer Vodka
> 255 Sverige 700ml 229.00 kr ( 327.14)
> 600ml 229.00 kr ( 381.67)
> Vikingfjord Vodka
> 298 Norge 700ml 224.00 kr ( 320.00)
> Wyborowa
> 124 Polen 700ml 217.00 kr ( 310.00)
> 350ml 115.00 kr ( 328.57)
> 600ml 254.00 kr ( 423.33)
> ............................................
> Hälsningar
> drF
-----------Znaczy siem, że Pan Dochtór też se lubi chlapnąć??? :::;;;;
Skåååull, föoor faaaun:))))



• ((((((-....SystemBolaget.........-))))))) IP: *.cm-upc.chello.se
Gość: DrF 19.05.02, 21:03 zarchiwizowany





www.systembolaget.se/


BRÄNNVIN, okryddat
Artikel med blåmarkerat pris finns i samtliga butiker

Varunamn Årg Varunr Land Volym Pris Kr / liter
32 Brännvin
231 Sverige 700ml 165.00 kr ( 235.71)
350ml 94.00 kr ( 268.57)
38 Brännvin
204 Sverige 700ml 194.00 kr ( 277.14)
350ml 103.00 kr ( 294.29)
60 Brännvin
286 Sverige 700ml 314.00 kr ( 448.57)
Absolut Vodka
88 Sverige 700ml 229.00 kr ( 327.14)
350ml 126.00 kr ( 360.00)
600ml 228.00 kr ( 380.00)
Brännvin Special
158 Sverige 700ml 169.00 kr ( 241.43)
350ml 95.00 kr ( 271.43)
Dufvenkrooks Vodka
62 Sverige 700ml 192.00 kr ( 274.29)
Explorer Vodka
3 Sverige 700ml 198.00 kr ( 282.86)
350ml 105.00 kr ( 300.00)
Finlandia
63 Finland 700ml 228.00 kr ( 325.71)
350ml 119.00 kr ( 340.00)
600ml 223.00 kr ( 371.67)
Koskenkorva
53 Finland 700ml 199.00 kr ( 284.29)
350ml 104.00 kr ( 297.14)
Koskenkorva Viina
233 Finland 700ml 195.00 kr ( 278.57)
Kronvodka
4 Sverige 700ml 210.00 kr ( 300.00)
350ml 113.00 kr ( 322.86)
Moskovskaya
32 Ryssland 700ml 209.00 kr ( 298.57)
Patron Vodka
11 Tyskland 700ml 194.00 kr ( 277.14)
Renat Brännvin
1 Sverige 700ml 204.00 kr ( 291.43)
350ml 108.00 kr ( 308.57)
500ml 169.00 kr ( 338.00)
Seriously Vodka
47 Sverige 700ml 231.00 kr ( 330.00)
Skyy Vodka
61 USA 700ml 229.00 kr ( 327.14)
600ml 229.00 kr ( 381.67)
Smirnoff
108 Storbritannien 700ml 224.00 kr ( 320.00)
500ml 199.00 kr ( 398.00)
350ml 118.00 kr ( 337.14)
Stolichnaya Cristall
77 Ryssland 700ml 249.00 kr ( 355.71)
Stolichnaya Vodka
91 Ryssland 700ml 229.00 kr ( 327.14)
Svensk Vodka Lake Vättern
5 Sverige 700ml 209.00 kr ( 298.57)
500ml 180.00 kr ( 360.00)
Svenskt Brännvin 1467
234 Sverige 700ml 229.00 kr ( 327.14)
Thors Hammer Vodka
255 Sverige 700ml 229.00 kr ( 327.14)
600ml 229.00 kr ( 381.67)
Vikingfjord Vodka
298 Norge 700ml 224.00 kr ( 320.00)
Wyborowa
124 Polen 700ml 217.00 kr ( 310.00)
350ml 115.00 kr ( 328.57)
600ml 254.00 kr ( 423.33)
............................................
Hälsningar
drF


• Re: Absolut Sanning & Vita Lögner.........-)))))))
wild2 19.05.02, 19:33 zarchiwizowany

Gość portalu: DrF napisał(a):

> wild2 napisał(a):
>
> Tusen tack, herr dr :)
> Ale mnie ten Absolut Sanning tak strasznie ściął ;) hehehhehe,
> że popatrzem jutro (no i bez funfli i oddziałowej tyż :P)
> Skåååull föuuur faaaun :))))

> glad pingst och Skåååull föuuur faaaun och Skåå&a
> ring;uuune :))))
> Absolut Sanning måste spetsas med ngra Vita Lögner...:)))
> pz dr F
---------------------
Hhehehehe :))Eller kanske med Vargtass.. eller Beska Droppar? :P

SWIAT NA TERAPIE !!!

Re: SWIAT NA TERAPIE !!! n/t IP: *.cm-upc.chello.se
Gość: copy; 01.09.02, 17:41 zarchiwizowany

www.urantia.org/detail.html


• Re: --------------------AQUANET----------IIIII IP: *.toya.net.pl
Gość: Sala 01.09.02, 12:41 zarchiwizowany

qqN A ECRIT UNE NOTE.
uNE MAUVAISE NOTE.
JE LE SAIS.
Je connais cette personne.
On peut ecrire des notes contre des collegues?
Avec lesquels on travaille?
La premiere lettre de l'homme qui a ecrit cette fameuse note, c'est "DOUBLE
VAIS"
Pourquoi?Pourquoi?
On peut punir qqn mais il faut bien choisir le methode.
IIIII
Tu sais j'ai faim...je n'ai rien.
Je peux le supporter mais je ne peux pas permetrre de faire qqch de mal a qqn
qui est AIME par moi.
Tu sais la chanson Quand on a que l'amour?
Je t'embrasse
Sala


• SWIAT NA TERAPIE !!! n/t
datsh 01.09.02, 01:26 zarchiwizowany


--
!


• Re: LATAJACY UNIWERSYTET na FORUM
verbal.kint 30.08.02, 12:40 zarchiwizowany

nie działa mi


• Re: POLSKO NA TERAPIE !!!
ihve 30.08.02, 11:45 zarchiwizowany

popieram


• POLSKO NA TERAPIE !!!
drf 30.08.02, 10:37 zarchiwizowany

rabaty grupowe


• LATAJACY UNIWERSYTET na FORUM IP: *.cm-upc.chello.se
Gość: 12;שנן3 28.08.02, 20:12 zarchiwizowany

DATA
komputerJiddish dla prOgramistow


• LATAJACY UNIWERSYTET na FORUM
drf 28.08.02, 18:07 zarchiwizowany

www.acceleratedchange.com/cgi-bin/dcforum/dcboard.cgi
www.acceleratedchange.com/cgi-bin/dcforum/dcboard.cgi?az=list&forum=DCForumID6&conf=DCConfID2

www.acceleratedchange.com/dcforum/DCForumID6/1018.html#2


• Re: --------------------AQUANET------------------
zupagrzybowa 28.08.02, 00:34 zarchiwizowany

masz racje Sala
jak sie mowi o pieniadzach to konczy sie humor
ale tak byc nie musi
:))))
ps co sie dzieje na forum ,
nastepna rewolucja ?
pzdr


• Re: --------------------AQUANET------------------ IP: *.toya.net.pl / *.toya.net.pl
Gość: Sala 27.08.02, 23:17 zarchiwizowany

Co do nagrody, to po pierwsze nie ladnie jest sobie robic jaja z tych co np.
nie maja pieniedzy.
:)))
A moze tu tacy sa.


• ............................. |====> AQUANET<====|
zupagrzybowa 27.08.02, 09:43 zarchiwizowany

WWW.MESZUGE.NET


• Re: --------------------AQUANET------------------
rabin3 27.08.02, 01:12 zarchiwizowany

sala.hamil napisała:

> Gazeta.pl > Forum > Aktualności Poniedziałek, 26 sierpnia 2002
>
> Kraj
> cmentarz żydowski w w-wie-wstyd panowie
> sala.hamil@poczta.gazeta.pl

co na to powiedza w NY ?
szalom sala


• JUDAIZM PRZYSZLOSCI
rabin3 27.08.02, 00:28 zarchiwizowany

Gość portalu: -------- napisał(a):

news.bbc.co.uk/olmedia/1765000/images/_1768059_newman300.jpg


• Re: --------------------AQUANET------------------
sala.hamil 26.08.02, 23:44 zarchiwizowany

Gazeta.pl > Forum > Aktualności Poniedziałek, 26 sierpnia 2002

Kraj
cmentarz żydowski w w-wie-wstyd panowie
sala.hamil@poczta.gazeta.pl


• Re: nagroda dla uczestnikow dyskusji !!! IP: *.chello.pl
Gość: kunce 26.08.02, 23:29 zarchiwizowany

niespodzianka?

dla mnie manna.

dlaczego nie przepiórki?


• Re: ..................sala cie szuka QnCe
sala.hamil 26.08.02, 23:16 zarchiwizowany

PRZECZYTALAM.
PAX....
TAKIE PIEKNE SLOWO, TAK RZADKO SPOTYKANE...
nawet miedzy dwojgiem najblizszych sobie osob...
wiesz rebe to trudne slowo :
nie do wymowienia
ale do przelkniecia....
--
sala.hamil@poczta.gazeta.pl


• ..................sala cie szuka QnCe
rabin3 26.08.02, 23:09 zarchiwizowany

www.jta.org/page_view_story.asp?intarticleid=11724&intcategoryid=5



Roger Pic

Marcel Marceau as Bip.


PROFILE
Marcel Marceau deals with WWII
by channeling memories into mime
By Tom Tugend



LOS ANGELES, Aug. 18 (JTA) — On his Internet site, Marcel Marceau’s biography
begins in 1946, when he enrolled in a theater arts school in Paris.
Marceau, whose nickname as “the world’s greatest mime” is so universal that it
seems part of his name, was then 23 years old. What happened during those
formative years influenced his career and may be the most dramatic chapter of
his life.

The artist, who recently appeared here, was born Marcel Mangel, the son of a
kosher butcher with socialist leanings, in the French city of Strasbourg, near
the border with Germany.

With the Nazi conquest of France in 1940, Marcel and his older brother Alain
escaped to the city of Limoges, where he studied decorative arts.

The training proved valuable two years later, when the brothers joined the
French Resistance, and Marcel was put to work forging new identity cards for
young Frenchmen trying to avoid the German forced labor draft.

To hide their Jewish backgrounds, Marcel created IDs for his brother and
himself, adopting the last name of Marceau, made famous by a general who
fought in the French Revolution.

In 1943, at the initiative of a cousin, young Marcel joined a ring for
smuggling Jewish children out of France and into Switzerland.

“I went disguised as a Boy Scout leader and took 24 Jewish kids, also in scout
uniforms, through the forests to the border, where someone else would take
them into Switzerland,” Marceau recalled during a recent interview.

He undertook the perilous journey three times, helping to save more than 70
children.

Marceau moved to Paris after its liberation in 1944 and joined the French
army. Because of his knowledge of English, he was attached as a liaison
officer to Gen. George Patton’s Third Army and there scored his
first “professional” success.

“I entertained the GIs in pantomime and my first ‘review’ was in the U.S. Army
paper ‘Stars and Stripes,’ ” he says.

At war’s end, Marceau returned to his native Strasbourg.

“Our house was empty, but all the furniture had been stolen,” he recalls.

He also learned that his father had been deported in 1944 and murdered in
Auschwitz.

The artist later incorporated this experience in one of his most elaborate
sketches, “Bip Remembers.”

In it, says Marceau, “I go back in memory to my childhood home, how my father
took me on a carousel, I show life and death in war, I show Hitler and waves
of soldiers being mowed down by machine guns.”

“Bip Remembers” is the only performance in his vast repertoire that
consciously draws on his childhood experiences.

“Bip is not a Jewish character,” Marceau says. “I respect our history and
suffering and I am sure that the fact I was born a Jew and was in the
underground has had an influence. But in my art I belong to the world, beyond
religion, to Jews, Christians and even Muslims.”

He expresses whatever religious feelings he has in his “Creation of the World”
act, based on Genesis.

“When I was once performing in America, 35 priests came to see ‘Creation of
the World’ and then asked me, ‘Are you religious?’ ” Marceau says. “I
answered, ‘I do not practice religion but when I do ‘Creation of the World,’
God enters in me.’ ”

Marceau has performed in Israel three times, first in 1949 and most recently
in 1995.

He is currently reading David Shipler’s “Arab and Jew: Wounded Spirits in a
Promised Land,” and insists, “We have to find peace.”

He is also concerned about a surge of anti-Semitic incidents in his native
France, but is certain that “we will overcome it.”

He takes confidence from the response of France’s young people to the recent
presidential bid by extreme right winger Jean-Marie Le Pen.

“The young people came out in the streets in opposition,” Marceau says. “I am
sure fascism will not succeed in France.”

Marceau’s face, without Bip’s white makeup, has naturally aged, but his body
is still taut and agile at 79.

“As time goes on, my art deepens,” he says. “I know I will die some day, but
until then I will continue to work with all my power.

“What counts for me now is humanity,” he says. “We must have peace — even with
Islam — or we will be destroyed.”





• |||||||||||||||||||||||||||||||oD IIIII |||||||||
rosolek 26.08.02, 18:51 zarchiwizowany

prosze sie skoncentrowac na solar plexus i obserwowac dlugosc wdechu i wydechu
obliczyc srednia dzienna i podzielic przez ilosc dotychczasowych dni zycia

powinno byc wdech 7 sek wstrz 11 oddech 13

funkcjonuje na 100%


• Do IIIII IP: *.toya.net.pl
Gość: Sala 26.08.02, 17:16 zarchiwizowany

Na pomoc...........
Na pomoc...
Au secours!!!!!!!
Help!


• Re: --------------------AQUANET-----------------
zupa_w_proszku 26.08.02, 14:19 zarchiwizowany

www2.gazeta.pl/forum/794674,30353,794652.html?f=50&w=2781300&a=2791060
--
z_w_p


• Re: --------------------AQUANET----------------- IP: *.cm-upc.chello.se
Gość: copy; 26.08.02, 13:09 zarchiwizowany

The Next Generation

Ž¿–âƒR?[ƒi?[

?V‚½‚ÈŽ¿–â‚̃??[ƒ‹‚ª‰½’Ê‚©“Í‚«‚Ü‚µ‚½?B?¥”ñŠF—l‚¨“š‚¦‚¨‘Ò‚¿‚µ‚Ă܂·?I?I


-------------------------------------------------------------------------------
-

Star
Trek‚É‚¨‚¢‚Ä?A?u‚±‚ê‚͂Ȃñ‚ÌŽ–‚¾‚낤?v‚Æ‹^–â‚ÉŽv‚¤Ž–‚Í‚½‚­
‚³‚ñ‚
‚邯Žv‚¢‚Ü‚·?B‚±‚̃R?[ƒi?[‚Å‚Í?A‚»‚¤‚¢‚Á‚½‹^–â‚É‚¨“š‚¦‚·‚éƒR?[ƒi?[‚Å‚·?B


?u‚¨‚¢?A‚¿‚å‚Á‚Ƒ҂Ăæ?A‚Æ‚¢‚¤Ž–‚Í?A‚¨‚Ü‚¦‚ª‚·‚ׂĂ̎¿–â‚ɉñ“š‚·‚é‚Á‚ÄŽ–?v


‚È‚©‚È‚©—Ç‚¢Ž¿–â‚Å‚·‚ª?A‚à‚¿‚ë‚ñ?AŽ„‚Å“š‚¦‚ç‚ê‚鎖‚Í“š‚¦‚Ü‚·‚ª?A“–‘R‚í‚©‚ç‚È‚¢
Ž–‚Ì•û‚ª‘½‚¢‚ÆŽv‚¢‚Ü‚·?B‚»‚±‚Å?AŽ„‚ª‚í‚©‚ç‚È‚¢?ê?‡‚Í?AŠF—l‚©‚çƒ??[ƒ‹‚ð‚à‚ç‚¢‰
ñ“š‚µ‚Ä‚¢‚«‚½‚¢‚Æ?l‚¦‚Ä‚¢‚Ü‚·?B


‚Ü‚½?A‚±‚ÌŽ¿–âƒR?[ƒi?[‚Å‚Í?AŽ„‚Ì‚g‚o‚Å?A‚±‚±‚ª‚¨‚©‚µ‚¢‚Æ‚¢‚¤ƒ??
[ƒ‹‚àŽó‚¯•t‚¯‚Ä‚¨‚è‚Ü‚·?B

yyyrun@po1.kikimimi.ne.jp


-------------------------------------------------------------------------------
-

‚³‚Ä?AŽ¿–â‚̃??[ƒ‹‚𒸂«‚Ü‚µ‚½?BŠF—l‚̃??[ƒ‹‚ł̌ä‰ñ“š‚¨‘Ò‚¿‚µ‚Ä‚¨‚è‚Ü‚·?B


Q11‚±‚ñ‚É‚¿‚Í?AƒgƒŒƒbƒL?[—ð‚P‚T”N‚Ì?uƒJ?[ƒN?D‚«?v‚Å‚·?BŽ„‚Ì‹^–â‚ð‚º‚Ð‚Í‚ç‚µ‚Ä‚­
‚¾‚³‚¢?B
ƒRƒoƒ„ƒVƒ}ƒ‹ƒeƒXƒg‚ɂ‚¢‚Ä‹³‚¦‚Ä‚­‚¾‚³‚¢?B
‰F’ˆ‘å?ì?í‚â?V‰F’ˆ‘å?ì?í‚̃mƒxƒ‰ƒCƒY‚ð“Ç‚ñ‚Å‚¢‚邯?AƒAƒJƒfƒ~?
[‚Å?s‚í‚ê‚鎎Œ±‚É?uƒRƒoƒ„ƒVƒ}
ƒ‹ƒeƒXƒg?v‚Æ‚¢‚¤‚Ì‚ª‚łĂ«‚Ü‚·‚ª?A‚¢‚Á‚½‚¢‚Ç‚ñ‚È“à—
e‚ÌŽŽŒ±‚È‚ñ‚Å‚µ‚傤‚©?B‚È‚ñ‚Å‚à‚±‚̃eƒXƒg‚ɃNƒŠƒA‚µ‚½?l‚̓sƒJ?
[ƒh‚ÌŽž‘ã‚Ü‚Å?A?”?l‚µ‚©‚¢‚È‚¢‚炵‚¢‚̂ł·‚ª?c
‚Ç‚ñ‚È?î•ñ‚Å‚à‚¢‚¢‚Å‚·?B‚±‚Ì‚à‚â‚à‚₵‚½‹CŽ?‚¿‚ð‚͂炵‚Ä‚­‚¾‚³‚¢?B

Q10.Œ»?݃rƒfƒI‚Å?o‚Ä‚¢‚é?AƒWƒFƒlƒŒ?
[ƒVƒ‡ƒ“ƒY‚Ì?Å?IŠª‚¾‚Á‚½‚ÆŽv‚¤‚ñ‚Å‚·‚ª?E?E?EƒsƒJ?[ƒh‚ª‚Ó‚í‚Ó‚í‚Æ–²‚Ì—l‚È?A—H‘Ì—
£’E‚̂悤‚È?A‚È‚ñ‚©‚»‚ñ‚ÈŠ´‚¶‚ɂȂÁ‚ăGƒ“ƒ^?[ƒvƒ‰ƒCƒY‚̘L‰
º‚ð‚Ó‚í?`?`?`‚Á‚Æ?i‚ñ‚Å‚¢‚邯?A‚»‚±‚É‚¢‚é‚Í‚¸‚̂Ȃ¢’N‚©‚ª‚¢‚ĂȂñ‚©?Aƒnƒ“ƒ}?
[Œ©‚½‚¢‚̂łª‚¿‚ñ‚ª‚¿‚ñ‚â‚Á‚Ă邯‚¢‚¤ƒV?
[ƒ“‚ª‚
‚Á‚½‚ÆŽv‚Á‚½‚ñ‚Å‚·‚ª?B?i‚í‚©‚é‚©‚È?`?`?H?H‚Ȃɂ¹?A‚©‚È‚è‘O‚Ì‚±‚ƂȂà‚ñ‚Å
?E?E?E?j‚»‚̃V?[ƒ“‚ňê?u‚È‚ñ‚Å‚·‚ª?A‰æ–
Ê‚Ì?¶?ã‚Ì•û‚¾‚Á‚½‚ÆŽv‚¢‚Ü‚·‚ª?AƒhƒA‚Ì‘O‚É’N‚©‚ª?À‚Á‚Ä‚¢‚é‚Ì‚ªŒ©‚¦‚é‚̂ł&m


• --------------------AQUANET------------------
drf 26.08.02, 03:34 zarchiwizowany

www.nie.com.pl/info_d.php?id=4


• Re: N IP: *.cm-upc.chello.se
Gość: copy; 26.08.02, 02:11 zarchiwizowany

www.nie.com.pl/main.php?dzial=forum&id_p=35&id_m=2


• nagroda dla uczestnikow dyskusji !!!
agora2 26.08.02, 00:41 zarchiwizowany

ps niespodzianka !!!

pss dla nas tez

pzdr
dyrektor


• Re: a gdyby tak zacząć od nowa? IP: *.lodz.cvx.ppp.tpnet.pl
Gość: Miriam 26.08.02, 00:34 zarchiwizowany

Gość portalu: kunce napisał(a):

> tylko co to znaczy: zacząć od nowa?

co to znaczy: co to znaczy?
zaczynać od nowa? zaczynać czyli robić coś od początku? jak mozna robić coś "od
poczatku od nowa"? Oopsss. Przydałyby się koany. Jeden. Nie przychodzi mi żaden
do głowy i to jest moje zen przedsenne.

Niech wypłynie sobie...


• Re: a gdyby tak zacząć od nowa? IP: *.chello.pl
Gość: kunce 25.08.02, 23:37 zarchiwizowany

tylko co to znaczy: zacząć od nowa?


• a gdyby tak zacząć od nowa? IP: *.chello.pl
Gość: kunce 25.08.02, 23:36 zarchiwizowany



• Re: __________________________________________dzi IP: *.toya.net.pl / *.toya.net.pl
Gość: Sala 24.08.02, 12:00 zarchiwizowany

NLP....
co o tym myslicie ?


• __________________________________________dziekuje IP: *.cm-upc.chello.se
Gość: 13; 24.08.02, 00:46 zarchiwizowany




ש

# Title Name: Main Author, Creator, etc. Full Title Date
[ 1 ] NLP & Imagination : Grundannahmen, Methoden, Möglichkeiten und
Grenzen / Weerth, Rupprecht, 1960- NLP & Imagination : Grundannahmen,
Methoden, Möglichkeiten und Grenzen / Rupprecht Weerth ; Vorwort, Jürgen
Kriz. 1992
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
BF637.N46 W44 1992

[ 2 ] NLP & Imagination II : die Untersuchung zum Buch, Daten & Fakten /
Weerth, Rupprecht, 1960- NLP & Imagination II : die Untersuchung zum Buch,
Daten & Fakten / Rupprecht Weerth. 1993
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
BF637.N46 W43 1993

[ 3 ] NLP alert NLP health labor relations alert / prepared by the law
firm of Jackson, Lewis, Schnitzler & Krupman. 1981
ACCESS:
Law Library Reading Room (Madison, LM201) CALL NUMBER:
KF3580.H4 A134

[ 4 ] NLP at work : the difference that makes a difference in business /
Knight, Sue. NLP at work : the difference that makes a difference in
business / Sue Knight. 1995
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
BF637.N46 K55 1995

[ 5 ] NLP for trainers : communicating for excellence / Alder, Harry. NLP
for trainers : communicating for excellence / Harry Alder. 1996
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
HF5549.5.T7 A45 1996

[ 6 ] NLP für Profis : Glaubenssätze & Sprachmodelle / Jochims, Inke. NLP
für Profis : Glaubenssätze & Sprachmodelle / Inke Jochims. 1995
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
BF637.N46 J63 1995

[ 7 ] NLP health labor relations alert NHP health labor relations alert /
prepared by the law firm of Jackson, Lewis, Schnitzler & Krupman. 198u
ACCESS:
Law Library Reading Room (Madison, LM201) CALL NUMBER:
KF3580.H4 A134

[ 8 ] NLP procedure SAS/OR technical report : the NLP procedure. 1997
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
T57.8 .S27 1997

[ 9 ] NLP solutions : how to model what works in business and make it work
for you / Knight, Sue. NLP solutions : how to model what works in business and
make it work for you / Sue Knight. 1999
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
HF5549.5.T7 K617 1999 Overflow

[ 10 ] NLP : tekhniki rossyp´iu / Gorin, Sergei. NLP : tekhniki rossyp´iu /
Sergei Gorin. 1999
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:


[ 11 ] NLP : the new technology of achievement / NLP : the new technology
of achievement / NLP Comprehensive Training Team ; edited by Steve Andreas and
Charles Faulkner ; contributing authors, Steve Andreas ... [et al.]. 1994
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms CALL NUMBER:
BF637.N46 N57 1994

[ 12 ] NLP und Systemtheorie Büschges-Abel, Winfried. Zur
konstruktivistischen Begründung eines am neurolinguistischen Programm
orientierten Handlungskonzeptes bei Lernstörungen : ein Theorieentwurf mit
ausgewählten Fallbeispielen / Winfried Büschges-Abel. 1997
ACCESS:
Jefferson or Adams Bldg General or Area Studies Reading Rms

ש




• NIC TO NIKOGO nie OBCHODZI !!!! IP: *.cm-upc.chello.se
Gość: y; 23.08.02, 15:25 zarchiwizowany

a moze obchodzi...???
;)


• PROBA MIKROFONU IP: *.cm-upc.chello.se
Gość: y; 20.08.02, 00:44 zarchiwizowany

channels.real.com/vram/single?programs=181&tcode=181


• D o M B O ż Y ?
ihve 19.08.02, 09:53 zarchiwizowany

zupagrzybowa napisał(a):

zupagrzybowa napisał(a):

///////////////////\\\\\\\\\\//////////\\\\\\\\\\\
http://www.idf.il"target="_blank">www.idf.il
///////////////////\\\\\\\\\\//////////\\\\\\\\\\\

Shema Yisroel, Adonoi Elohinu, Adonoi Echod !



• ZYCIE SMIERC i stan posredni...
ihve 19.08.02, 09:49 zarchiwizowany

Gość portalu: *pan* napisał(a):

www.jraxis.com/atheism/simulator/
czy nie za proste ?
++© ?



• Re: sorry...linki sie skleily /tak jak kasza... IP: *.chello.pl
Gość: kunce 18.08.02, 00:23 zarchiwizowany

otworzyło się. Jakiś czas spędziłam w ogrodach.
"O, wiśnio górska! Wzajem sobie współczujemy. Moja samotność bowiem całkiem nie
jest odmienna od samotności kwiatów" pisał smutno mnich Gyóson w XII w.

A jakaż samotność w ogrodach? Tak jak w wielkim mieście ludzie, tak rośliny
towarzyszą sobie na zbyt ciasnej przestrzeni i muszą urozmaicać sobie życie.
To krzepiące.
Cholera, staję się sentymentalna. Sorki. Nie odsyłaj mnie wiecej na łono natury.


• sorry...linki sie skleily /tak jak kasza... IP: *.cm-upc.chello.se
Gość: drf 17.08.02, 23:20 zarchiwizowany

academic.bowdoin.edu/zen/Garden.scgi?GardenID=5&ViewID=82


• Re: ..........................czy lubisz kasze ma IP: *.chello.pl
Gość: kunce 17.08.02, 23:01 zarchiwizowany

nie. Zmuszana w dzieciństwie wymiotowałam w talerzyk - nie byłam w stanie jej
przełkąć.
Nie przepadam za potrawami na mleku - toleruję je tylko w kawie.

PS. nie jestem w stanie otworzyć ostatniej strony www. (?)


• koany zenu...? IP: *.cm-upc.chello.se
Gość: drf 17.08.02, 23:00 zarchiwizowany

academic.bowdoin.edu/zen/intro_template.shtml?ryoan
manna ducha ?
pzdr
drf


• ..........................czy lubisz kasze manną ?
drf 17.08.02, 22:55 zarchiwizowany

Gość portalu: kunce napisał(a):

każdy człowiek, kiedy odkrywa swoją prawdziwą naturę, przełamuje całą ciemność,
negatywność, konceptualne myślenie. Jest to jak odkrycie przejrzystego nieba
bez żadnych chmur.
Ba, czy na pewno duchowy lazur jest piękniejszy od zmiennej gry obłoków?
-----------------------------------------------------------
www.dailyzen.com/http://academic.bowdoin.edu/zen/intro_template.shtml?ryoan

czy lubisz kasze manną ?


• ...jest jak pióro pawia IP: *.chello.pl
Gość: kunce 17.08.02, 22:24 zarchiwizowany

każdy człowiek, kiedy odkrywa swoją prawdziwą naturę, przełamuje całą ciemność,
negatywność, konceptualne myślenie. Jest to jak odkrycie przejrzystego nieba
bez żadnych chmur.

Ba, czy na pewno duchowy lazur jest piękniejszy od zmiennej gry obłoków?


• :::::::::::::::::::::::::::::::::::::::::::::::::: IP: *.cm-upc.chello.se
Gość: :::::::::: 15.08.02, 23:35 zarchiwizowany

www.grunch.net/synergetics/images/grunch.gif


• Terraforming System
drf 15.08.02, 15:03 zarchiwizowany

easyweb.easynet.co.uk/~robodyne/stellar/teraform.htm


• TAJEMNICA GLOBALIZMU poprawiona.... IP: *.cm-upc.chello.se
Gość: drFröjd 15.08.02, 00:58 zarchiwizowany

Gość portalu: drf napisał(a):

www.anthonyhuntassociates.co.uk/eden-project.htmhttp://www.aidomes.com
www.domehomes.com


• ..............................TAJEMNICA GLOBALIZMU IP: *.cm-upc.chello.se
Gość: drf 15.08.02, 00:55 zarchiwizowany

www.anthonyhuntassociates.co.uk/eden-project.htmhttp://www.aidomes.com
www.domehomes.com/


• Re: mea culpa! IP: *.pai.net.pl
Gość: Sala 14.08.02, 23:05 zarchiwizowany

no tak nawet na Aquanecie jest Row Marianski.
:)))



• mea culpa! IP: *.chello.pl
Gość: kunce 14.08.02, 22:40 zarchiwizowany

weszłaś na forum, kiedy słynny watek Tyu z przesłaniem z Małego Księcia
(najważniejsze jest niewidzialne dla oczu) stał sie juz historią, ale historią
znaczącą (ponad 600 wpisów, wiekszość wypowiedzi naprawdę wartościowych).
Dlatego mówiłam o parafrazowaniu Tyu, czego nie mogłas zrozumieć... sorki.
Pod kreacja czasami jest manekin. Drf zdaje sie jednak wierzyć (tak to
odbieram), że błahe rozmowy mogą nie oddawac naszej głębi (???)


• Re: ponownie dobry wieczór! IP: *.pai.net.pl
Gość: Sala 14.08.02, 22:34 zarchiwizowany

Najladniejsz jest .....
napisal Antoine de Saint Exuper'y
N'est ce pas?
Sala
PS. Grzebiac sie w zakamarkach wlasnej duszy predzej czy pozniej trafimy na
kratke pod ktora sa scieki.
A to kto napisal?
Czasem pod kreacja jest niewiele...
Albo nic ciekawego....


• Re: ponownie dobry wieczór! IP: *.chello.pl
Gość: kunce 14.08.02, 22:31 zarchiwizowany

to możliwe, ale drf zdaje się sądzić, że - parafrazując Tyu - najładniejsze
jest niewidzialne dla oczu - czyli to co pod kreacją...

zresztą zaczekajmy na jego jednoznaczną opinię w tej sprawie.


• Re: ponownie dobry wieczór! IP: *.pai.net.pl
Gość: Sala 14.08.02, 21:57 zarchiwizowany

Nie ma to jak kreacja. Kreacja jako rzeczownik abstrakcyjny lub kreacja na
wieczór. Nieprawdaż?
Sala


• ponownie dobry wieczór! IP: *.chello.pl
Gość: kunce 14.08.02, 21:54 zarchiwizowany

zaczynam cytatem:
JA -czy chodzi o to ze my (forumowicze, czy Ty i ja) w prawdziwym życiu
jestesmy bardziej oryginalni niz tutaj?
TY -zgadza sie

zastnawiające. Zwykle uważa się, ze takie środowiko jak forum daje mozliwość
sporej autokreacji (czyli świadomego oszukiwania na swój temat). Tu
prezentujemy się w najokazalszej pozie i szacie - jak na portretach w stylu
paradno-dworskim.
Dlaczego zatem uważasz, że - paradoksalnie - my tracimy? (my - czyli wszyscy?
czy tylko Ty i Twoja rozmówczyni?)





• ..................................... IP: *.cm-upc.chello.se
Gość: #8710;∆ 14.08.02, 20:33 zarchiwizowany

www.sld.org.pl/index.php?current_lang=polish&pid=18&f=1&id=77&cmd=show


• +++&# 9608;LEVO&# 9608;+++ IP: *.rrcnet.com
Gość: #8706;∆∆∂∂ 14.08.02, 00:35 zarchiwizowany

\lp.gro.dls.www\\:ptth


• dobranoc kunce ....sen czeka
drf 14.08.02, 00:17 zarchiwizowany

Gość portalu: kunce napisał(a):

> ale nie jestem astrologiem, więc może masz racje.
>
> drf napisał:
>
> > a co do unikalnosci to masz racje bo jestesmy wirtualnie mniej orginalni..
> .
>
> nie zrozumiałam (Doktorze, to jakiś kompleks?)- czy chodzi o to ze my
> (forumowicze, czy Ty i ja) w prawdziwym życiu jestesmy bardziej oryginalni
niz
> tutaj?
zgadza sie


• a zatem... biegnę sprawdzać IP: *.chello.pl
Gość: kunce 14.08.02, 00:11 zarchiwizowany

...Eden w plastrze miodu...??? hmmm... do jutra.


• kunce.......sprawdz to jescze raz w dzisiejszym ..
drf 14.08.02, 00:08 zarchiwizowany

snie...postaraj sie zapamietac szczegoly,...to wazne...


• Re: roznia sie / wg astrologii (pierwsze słysze) IP: *.chello.pl
Gość: kunce 14.08.02, 00:03 zarchiwizowany

ale nie jestem astrologiem, więc może masz racje.

drf napisał:

> a co do unikalnosci to masz racje bo jestesmy wirtualnie mniej orginalni...

nie zrozumiałam (Doktorze, to jakiś kompleks?)- czy chodzi o to ze my
(forumowicze, czy Ty i ja) w prawdziwym życiu jestesmy bardziej oryginalni niz
tutaj?


• roznia sie / wg astrologii
drf 13.08.02, 23:57 zarchiwizowany

a co do unikalnosci to masz racje bo jestesmy wirtualnie mniej orginalni...


• Re: panny urodzone pod inna szerokoscia geografic IP: *.chello.pl
Gość: kunce 13.08.02, 23:55 zarchiwizowany

...a zatem co z tymi pannami?


• panny urodzone pod inna szerokoscia geograficzna..
drf 13.08.02, 23:50 zarchiwizowany



• dziwna z ciebie panna IP: *.chello.pl
Gość: kunce 13.08.02, 23:45 zarchiwizowany

"unikalność" to pojemne słowo - oznacza wartość rzadko spotykaną, niezwykłą.
Ale jednocześnie wywodzi się od - unikania.
Dziadziuś Freud powiedział by pewnie, że nie bez powodu posłużyłeś się właśnie
tym wyrazem.
Ale zaraz. Kto tu jest DrF? Weszłam w nie swoją rolę.


• unikalnosc ale nie obcosc
drf 13.08.02, 23:38 zarchiwizowany

w koncu jestesmy wszyscy czescia tej samej rzeczywistosci...


• i tak już wkrótce zrobię IP: *.chello.pl
Gość: kunce 13.08.02, 23:32 zarchiwizowany

czy bycie istotą z innej planety to bycie obcym, czy bycie wyjątkowym?
(odpowiedź: "jedno i drugie" nie liczy się)


• ....i zawsze mozna wrocic do tego snu....
drf 13.08.02, 23:29 zarchiwizowany

i sobie siebie przypomiec w wyobrazeniach innych...


• jak przez mgłe.... IP: *.chello.pl
Gość: kunce 13.08.02, 23:21 zarchiwizowany

coś jakby Eden w plastrze miodu...?


• kunce.......naprawde NIC nie pamietasz ?
drf 13.08.02, 23:12 zarchiwizowany

www.anthonyhuntassociates.co.uk/eden_site_images_4.htm


• dobry wieczór w naszej jawie IP: *.chello.pl
Gość: kunce 13.08.02, 22:42 zarchiwizowany

DrF, czy spotkaliśmy się w moim śnie? (niestety, mało pamiętam)


• SPAM.gazeta.pl n/t
ur_soppa 13.08.02, 21:36 zarchiwizowany

www.anthonyhuntassociates.co.uk/eden_site_images_5.htm


• Jak chmury...
drf 13.08.02, 02:37 zarchiwizowany

"Jak chmury pojawiające się na pustym niebie, tak wszystkie koncepcje i myśli
zjawiają się w naszej wewnętrznej przestrzeni, a później znikają z powrotem w
pustce. "


• znak panny n/t
drf 13.08.02, 02:34 zarchiwizowany



• do zobaczenia w twoim snie n/t
drf 13.08.02, 02:29 zarchiwizowany

Jak chmury pojawiające się na pustym niebie...
drf


• Re: wracając do tematu. IP: *.chello.pl
Gość: kunce 13.08.02, 02:27 zarchiwizowany

drf napisał:

> od dziecinstwa chcialem zostac astronomem ,astronautem albo stota z innej
> galaktyki...

chyba najłatwiej zostać astrologiem (a propos - spod jakiego Doktor znaku?)


• sen, brat śmierci skleja mi powieki IP: *.chello.pl
Gość: kunce 13.08.02, 02:25 zarchiwizowany

nie doczekam sie odpowiedzi na wszystkie nurtujęce mnie pytania i pewnie dzis
ich nie zadam.
sen, zdaniem starozytnych, to brat śmierci. A śmierć, zdaniem Freuda, to
siostra Erosa. Strasznie skomplikowane sa te rodzinne stosunki władców krainy
nieswiadomości.
Ciekawe, kogo dziś tam spotkamy?


• Re: wracając do tematu.
drf 13.08.02, 02:24 zarchiwizowany

Gość portalu: kunce napisał(a):

> w zabawie w doktora należało uważać na małych chirurgów i stomatologów
> (rzadnych zabiegów). Reszta specjalizacji wydaje sie nie zagrażac zdrowiu.
>
> A drogi Doktor jakim lekarzem być lubił? czy zawsze lekarzem dusz (proszę
sie
> wygodnie położyć na kozetce, rozlużnic się, zamknąć oczi i powiedzieć,
co...)............................


od dziecinstwa chcialem zostac astronomem ,astronautem albo stota z innej
galaktyki...


• duch czy antyduch ?
drf 13.08.02, 02:15 zarchiwizowany

Gość portalu: kunce napisał(a):

> oczywiście przez podobieństwo do "teza" i "antyteza".
>
> mam nadzieję, że to hihi nie oznacza, iz fakultet spłaszczył moja myśl i
> doszukiwał się skojarzeń bardziej fizjologicznej, a nie duchowej natury?

o ile znam fakultet to on zadnej wlasnej mysli jeszcze nie wymyslil a mimo
iz posiada tyle mozgowej materii ma swiadomosc wyrostka robaczkowego...



• wracając do tematu. IP: *.chello.pl
Gość: kunce 13.08.02, 02:11 zarchiwizowany

w zabawie w doktora należało uważać na małych chirurgów i stomatologów
(rzadnych zabiegów). Reszta specjalizacji wydaje sie nie zagrażac zdrowiu.

A drogi Doktor jakim lekarzem być lubił? czy zawsze lekarzem dusz (proszę sie
wygodnie położyć na kozetce, rozlużnic się, zamknąć oczi i powiedzieć, co...)


• "hi...hi" to cytat...
drf 13.08.02, 02:06 zarchiwizowany

z helgi


• Re: koncept czy antykoncept IP: *.chello.pl
Gość: kunce 13.08.02, 02:03 zarchiwizowany

oczywiście przez podobieństwo do "teza" i "antyteza".

mam nadzieję, że to hihi nie oznacza, iz fakultet spłaszczył moja myśl i
doszukiwał się skojarzeń bardziej fizjologicznej, a nie duchowej natury?


• koncept czy antykoncept
drf 13.08.02, 01:59 zarchiwizowany

....fakultet zejdzie na hegle "...hihi"


• Re: ..................zabawa w doktora IP: *.chello.pl
Gość: kunce 13.08.02, 01:53 zarchiwizowany

w procesie poznawania świata ważna jest - jak sądzę - zarówno koncepcja, jak i
antykoncepcja.

co na to fakultet?


• ..................zabawa w doktora
drf 13.08.02, 01:51 zarchiwizowany

Gość portalu: kunce napisał(a):

> czy pamięta Pan Doktor z dzieciństwa przyjemniejszą zabawę niz zabawa w
doktora
> ?
pamietam oczywiscie , proces poznania swiata ma swoje przyjemne strony...
...czy masz jakas koncepcje ?


• nareszcie....!! IP: *.chello.pl
Gość: kunce 13.08.02, 00:41 zarchiwizowany

czy pamięta Pan Doktor z dzieciństwa przyjemniejszą zabawę niz zabawa w doktora?


• MOGA BYC DUZE LITERY tez n/t
drf 13.08.02, 00:34 zarchiwizowany



• po polsku, bez duzych liter...:))) IP: *.cm-upc.chello.se
Gość: ДФ 12.08.02, 15:41 zarchiwizowany

sala.hamil napisała:

> In english, mowmy po polsku, gawarim pa ruskij, parliamo italiano, parlons
> francais, dicimus latina.....
> No to wybieraj
> :))))))
> Sala
..........................................

pzdr
ФДФ


• Re: --------------------AQUANET------question
sala.hamil 12.08.02, 12:14 zarchiwizowany

In english, mowmy po polsku, gawarim pa ruskij, parliamo italiano, parlons
francais, dicimus latina.....
No to wybieraj
:))))))
Sala


• Re: www.virtualjerusalem.com
datsh 11.08.02, 14:35 zarchiwizowany

Gość portalu: -------- napisał(a):

www.virtualjerusalem.com/http://www.virtualjerusalem.com/sendaprayer/
forums.virtualjerusalem.com/messages/43/43.html?1012077726
www.spinner.com
!


• Re: --------------------AQUANET------question IP: *.cm-upc.chello.se
Gość: al Haj 11.08.02, 14:31 zarchiwizowany

Gość portalu: Sala napisał(a):

> I don't understand.
> You can write in englisch
> Thank you
> Sala
Thanx may be we can communicate in polish ?


• Re: --------------------AQUANET------question IP: *.toya.net.pl
Gość: Sala 06.08.02, 18:36 zarchiwizowany

I don't understand.
You can write in englisch
Thank you
Sala


• MISSFARSTAND HAR INTRAFFAT!!! :-©
drf 06.08.02, 01:50 zarchiwizowany

®©®
:-©


• Re: --------------------AQUANET------question
drf 06.08.02, 01:47 zarchiwizowany

Gość portalu: Regina Coeli napisał(a):

> Je dois faire qqch pour savoir d'ou qqn m'a envoye un e -mail.
> Que'est ce que je dois faire? Alors? Je serais bien reconnaissante de le
savoir
> .
> Votre Regina
sorry for my french men svenska gar det ganska smidig...vissa forveklingar har
intreffat och missfarstand som i grunt och bottem ar rene rama komiska episoder
i den har historien...som ar inte slut an.... mvh joe


• ................®...................Tłuszcz rybi !
drf 06.08.02, 01:41 zarchiwizowany

Gość portalu: Tłuszcz rybi napisał(a):

> dr_frojd napisał:
>
> > Gość portalu: ®©© napisał(a):
> >
> > > ®©©©® ®©©© ®©©
> ;&cop
> > y;®©®®©®®©®® ®©©&
> copy;
> > ®©©©®©®®©®®©® &
> reg;&
> > copy;©©®©®®©®®©®®®
> ;®
> > ;©®®©®®©®®®©
> > ®©©©®©®®©®®©®&re
> g;&re
> > g;®©®®©®®©®® ®©©&
> copy;
> > ®©®®©®® ®©©©®©&r
> eg;&r
> > eg;©®®©®®©®®©®®©&
> reg;&
> > reg;
>
> genialne ®©©©®
©®


• Re: --------------------AQUANET------question IP: *.160.235.*
Gość: oeli 05.08.02, 15:08 zarchiwizowany

Je dois faire qqch pour savoir d'ou qqn m'a envoye un e -mail.
Que'est ce que je dois faire? Alors? Je serais bien reconnaissante de le savoir.
Votre Regina


• Re: &# 9619;&# 9619;&# 9619;&# 9619;&# 9619;&# 9619; IP: *.160.235.*
Gość: Sala 05.08.02, 15:02 zarchiwizowany

I have one question.
nagijalima@poczta.onet.pl

Szalom
Sala


• Re: ®©©©©®©® IP: *.teimes.gr
Gość: rybi 04.08.02, 22:33 zarchiwizowany

dr_frojd napisał:

> Gość portalu: ®©© napisał(a):
>
> > ®©©©® ®©©© ®©©&cop
> y;®©®®©®®©®® ®©©©
> ®©©©®©®®©®®©® ®&
> copy;©©®©®®©®®©®®®®
> ;©®®©®®©®®®©
> ®©©©®©®®©®®©®®&re
> g;®©®®©®®©®® ®©©©
> ®©®®©®® ®©©©®©®&r
> eg;©®®©®®©®®©®®©®&
> reg;

genialne


• ®©©©©®©®®©®®&cop
dr_frojd 04.08.02, 21:49 zarchiwizowany

Gość portalu: ®©© napisał(a):

> ®©©©® ®©©©
®©©©®©®®©®®©®® ®©©©
®©©©®©®®©®®©®
®©©©®©®®©®®©®®®®©®®©®®©®®®©

®©©©®©®®©®®©®®®®©®®©®®©®®
®©©©®©®®©®®
®©©©®©®®©®®©®®©®®©®®©®®


• ®©©©®©®©©©®©&r IP: *.cm-upc.chello.se
Gość: py;©©®©®®©®®©®® 03.08.02, 00:13 zarchiwizowany

®©©©®©®®©®®©®®


• ''''''''''''''''''''''''''''''''''''''''''''''''''
szef3 01.08.02, 01:52 zarchiwizowany

story.news.yahoo.com/news?g=events/ts/080601mideast&tmpl=sl&e=2


• ©©®®©©®©®©®©&re
drf 31.07.02, 01:42 zarchiwizowany

©©®®©©®©®©®©®©©®®©©®®©©®©®©®©®©©®®©©®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®
®®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®©©®®©®©©®®©©®©®©®©®©©®®©©®©®©®©©®
©®©©®©®®®©®©®©©®©®®®©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®®®©©®®©©®©®©®©©®©
®©©®©®®®©®©®©©®©®®®©©®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®®©©®©®©®©®©©®
®©©®©®©®©©®©®©©®©®®®©®©©©®®©©®©®©®©®©©®®©©®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©
®©©®©®®®®©©®©®©®©®©©®®©©®©®©®©©®®©©®©®©®©®©©®®©©®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©
®®®©®©®©©®©®®®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®©©®®©®©©®®©©®©®©®©®©©
®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®®®©©®
®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®©©®©®©©®©®®®©®©®©©®©®®®©©®®©®©©®®©©®©®©®©®©©®®©©
®©®©®©©®©®©©®©®®®©®©®©©®©®®®©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®®®©©®®©©®
©®©®©©®©®©©®©®®®©®©®©©®©®®®®©©®©®®®©©®®©®©©®®©©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®
©®©©®©®®®©®©®©®©®©©®®©©®©®©®©©®©®©©®©®®®©®©®©©®©®®®®®©©®®©©®©®©®©©®©®©©®©®®®©®©
®©©®©®®®


• KONIEC PRZERWY OBIADOWEJ ! IP: *.cm-upc.chello.se
Gość: copy; 31.07.02, 01:09 zarchiwizowany

©


• : spaudaj z tyuogo wontku !!! IP: *.cm-upc.chello.se
Gość: 666 31.07.02, 01:08 zarchiwizowany

..............potwierdzam opinie szanownego poprzednika.............
i diagnoze dr f
fuck23
leczenie konieczne


• Re: spaudaj z tyuogo wontku !!!
barszcz_czerwony 30.07.02, 23:23 zarchiwizowany

Sicken gästfrihet !!!
Tauk föur det, du!
Ou besvâura mig inte möur, din vattniga snackare !!!


• AQUA ------------------ NET
drf 30.07.02, 15:29 zarchiwizowany

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓&#

Killing the Future

Killing the Future
salomon3 03.10.02, 12:12 zarchiwizowany

Response to Amnesty International's Report" Killing the Future:
" Killing the Future
salomon3 03.10.02, 12:12 zarchiwizowany

Response to Amnesty International's Report" Killing the Future:
"Children in the Line of Fire

For the past 2 years ,the IDF has been engaged in difficult and
intensive fighting against Palestinian terrorist factions .During this
period of fighting ,which was imposed upon the State of Israel and the
IDF ,Palestinian terrorist factions perpetrated over 14,500 terror
attacks ,claiming the lives of 624 Israeli civilians and IDF soldiers.

All IDF operations adhere to international humanitarian law ,in strict
compliance with the highest moral and legal standards .In glaring
contrast ,Palestinian terrorist factions defy all norms ,be they moral
or legal ,deliberately attacking civilians only because they are
Israeli ,as described at length in the report .Amnesty International
has labeled the Palestinian suicide attacks as crimes against humanity.

As part of its adherence to the rules of the conduct of war ,the IDF
goes to great lengths to avoid harming civilians ,especially children.
This concern is an integral part of soldier training ,of the
regulations governing when to open fire ,of orders issued by
commanders ,of operational plans ,and of the message conveyed by the
highest-ranking officers.

Regrettably ,some civilians ,including children ,have been injured
during the fighting against the Palestinian terrorist groups .In no
case were these injuries intentional .Those hurt were either
individuals involved in Palestinian terrorist activity ,or civilians
who were unintentionally hurt when they entered a live-fire zone.

The Palestinian terrorists are solely and unequivocally responsible
for the injuries caused to Palestinian children .Since the beginning of
the conflict two years ago ,the Palestinian terrorist factions have
cynically exploited children in terrorist activity ,in violation of
international law .Children are groomed and dispatched to carry out
;suicide attacks in the centers of the Israeli civilian population
positioned at the front lines of demonstrations to hide snipers behind
them ;and used to plant explosives and deliver weapons .Moreover ,the
terrorist factions have transformed Palestinian civilian population
centers into terrorist activity headquarters.

One must keep in mind that the Palestinian society and several
international organizations have denounced the abuse of children by
Palestinian terrorist factions .For one ,the UN Secretary General
."condemned the phenomenon in his report of operation" Defensive Shield
It must be mentioned that the Palestinians publicly acknowledged that
terrorist organizations paid Rafah Palestinian children 5 NIS) roughly
.equal to 1 ($each to thrust explosive charges towards IDF soldiers
Forty of those children were injured and became amputees) Alray
newspaper ,20 June 2002).
Unfortunately ,the UN report does not mention this particularly
abominable Palestinian practice.
Those who use children to perpetrate terror attacks and those who use
houses where children reside to coordinate and perpetrate attacks are
responsible for these childrens 'injuries.
Authors of the Amnesty report compare IDF operations in which
Palestinian children were killed to Palestinian terror attacks in which
Israeli children were killed .This comparison is unjustified and
baseless.
Palestinian terror attacks ,especially suicide bombings ,are designed
to cause the death of Israeli civilians ,including children .This is
ruthless ,unprecedented ,inhuman terror.
On the other hand ,IDF activity is conducted in accordance with the
laws of war and is not aimed at injuring civilians .Injuries are
occasionally sustained only because Palestinian terrorists act from
within Palestinian civilian population centers.
Hence ,equating the two sides is baseless ,and indicates a fundamental
lack of fairness amongst authors of the report.
The authors falsely claim the IDF does not investigate incidents in
which Palestinian children are injured ,and grants immunity to the
soldiers involved .The fact is that IDF commanders do investigate
incidents in which Palestinian civilians were injured .When suspicion
of criminal misbehavior by soldiers arises ,the Military Police
launches an inquiry .Since September 2000 ,the beginning of operation
Ebb and Flow ",over 220 inquiries have been launched by the Military"
Police ,including incidents in which Palestinian minors were injured.
As examples ,the Military Police launched inquiries regarding the
following incidents :the death of Palestinian children near Khan Yunis
on 22 November 2001 ;the death of Yasser Kassabi from Kalandia on 8
December 2001 ;the death of Muhamad Hassan Altalalaka near Beith Hanoun
on 1 March 2002 ;the death of children in Jenin on 21 June 2002 ;as
well as many other incidents.
The claims that incidents are not investigated and soldiers enjoy
immunity are false .The fact that the IDF investigates and establishes
commissions of inquiry ,even while in the midst of intense fighting ,is
part of its identity as a professional army.
The IDF is dedicated to upholding" purity of arms "and preserving
human dignity ,and regrets any injuries to innocent children .The IDF
emphasizes that the cynical use of Palestinian children by Palestinian
terrorist factions is the main cause of their injuries .The IDF
applauds the report's implicit condemnation of Palestinian terror
attacks against the Israeli civilian population.


www.idf.il/newsite/english/main.asp


<-----
ihve 02.10.02, 21:50 zarchiwizowany


ריואה ליח

יטירבה כ"בשה .5 - ייא .םא

ל"הצ ןויכרא

רקד תללוצה

לארשי תוכרעמ יללחל
רוכזי רתא

ימשרה רתאה - ל"הצ

תוילארשי תוללוצ

ב"הרא לש הנזאהה
תונכוס

ב"הרא - תיזכרמה ןויבה
תונכוס

תיאקירמאה טניגיסה
תליהק ירגוב תתומע



Re: Drogi Doktorze! Pobawmy się w listonosza!
ihve 02.10.02, 21:33 zarchiwizowany

Gość portalu: kunce napisał(a):

> hasło:
>
>
>
> odzew:
>
> ............
> ?

__________________________

odzew : <>


Re: Drogi Doktorze! Pobawmy się w listonosza! IP: *.chello.pl
Gość: kunce 02.10.02, 00:30 zarchiwizowany

hasło:



odzew:

............
?


Drogi Doktorze! Pobawmy się w listonosza! IP: *.cm-upc.chello.se
Gość: #60:> 02.10.02, 00:04 zarchiwizowany

Skrzynka kontaktowa?

Otoz to :)
Zgadzam sie!
Braaawo!!!!!






Putin & Sharon IP: *.cm-upc.chello.se
Gość: #60:> 01.10.02, 19:12 zarchiwizowany

www.jpost.com/
Oct. 1, 2002
Israel is not the Jews' only country, Putin tells Sharon
By HERB KEINON


MOSCOW Russian President Vladimir Putin corrected Prime Minister Ariel Sharon
yesterday when the later said Israel is the Jews' only country.

Wrong, Putin said, reminding Sharon of the Jewish autonomous region of
Birobidzhan set up under the Soviets.

Moreover, Putin invited Sharon to visit the area with him on his next visit,
an offer Sharon told leaders of the Jewish community last night to their
amusement he readily agreed to.

When the Soviets came to power they were in favor of autonomous regions for
ethnic groups in territorial concentration with their own language, culture,
and identity.

Birobidzhan was designated for the Jews, and a Soviet system of Jewish
education, press, literature, and theater developed in the 1920s and 1930s,
while many Jews remained determined to preserve Hebrew and genuine Jewish
culture. But the experiment petered out, due in part to assimilation and anti-
Semitism.

The issue of Birobidzhan came up when Sharon was using an argument on Putin he
has used a hundred times before on world leaders and various audiences that
Israel is willing to make concessions for peace, but not over the security of
its citizens because Israel is the only country the Jews have.

It is then that Putin raised his eyebrow.

Sharon related this story with humor to the leaders of the Jewish community,
and used it to show that Putin is both interested in the Jews, and concerned
with their fate.

He thanked Putin during their meeting for his unequivocal stance against anti-
Semitism, and publicly praised him for this in front of the Jewish audience as
well.

According to Sharon, Putin said there are now more Jews in Birobidzhan than
there were at the onset of the massive Soviet immigration wave in 1990.

Sharon said this bears out what he was told by Russian Chabad leaders that
there are still 3.5 million Russians who are qualified to immigrate to Israel
under the Law of Return.

Sharon said it is realistic to talk now about bringing another million Jews to
Israel from the former Soviet Union.

Putin, according to Sharon, is unique among the leaders of the world because
he takes a keen interest in his migr community. In fact, Sharon related, the
Russian president makes it a point to call after every terrorist attack and
ask for the names of the victims, to see whether they are Russian immigrants,
or even people he personally knew.

And in order to place Putin in an even more sympathetic light with his Jewish
audience, many of them wearing kippot, Sharon related that during his three-
hour meeting with Putin, the Russian president arranged for an unscheduled
lunch, and took pains to ensure it was kosher.

"During the meeting someone kept coming into the room and talking to him,"
Sharon said. "When I told the president that in Israel this usually means
something bad has happened, he replied that he was just informing his aid of
what is needed to make the lunch kosher."